Human VRK1(Vaccinia Related Kinase 1) ELISA Kit

Human VRK1(Vaccinia Related Kinase 1) ELISA Kit

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

RD-VRK1-Hu-48Tests 48 Tests
EUR 521

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

RD-VRK1-Hu-96Tests 96 Tests
EUR 723

Human Vaccinia Related Kinase 1 (VRK1)ELISA Kit

201-12-2457 96 tests
EUR 440
  • This Vaccinia Related Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Vaccinia Related Kinase 1(VRK1)ELISA Kit

QY-E02017 96T
EUR 361

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

SEC600Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Vaccinia Related Kinase 1 elisa. Alternative names of the recognized antigen: Serine/threonine-protein kinase VRK1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Vaccinia Related Kinase 1 (VRK1) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Vaccinia Related Kinase 1 (VRK1) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Vaccinia Related Kinase 1 (VRK1)

  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99986
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 29.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Vaccinia Related Kinase 1 expressed in: E.coli

Human Vaccinia Related Kinase 1 (VRK1) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Vaccinia Related Kinase 1(VRK1)ELISA Kit

QY-E10430 96T
EUR 361

Mouse Vaccinia Related Kinase 1(VRK1)ELISA Kit

QY-E21577 96T
EUR 361

Human Vaccinia Related Kinase 1 (VRK1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human VRK1 (Vaccinia Related Kinase 1)

ELK3275 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vaccinia Related Kinase 1 (VRK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V
  • Show more
Description: A sandwich ELISA kit for detection of Vaccinia Related Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1)

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Biotin.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Cy3.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with FITC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with HRP.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with PE.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: VRK1 (Gly46~Glu292)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC-Cy7.

Vaccinia Related Kinase 2 (VRK2) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Vaccinia Related Kinase 3 (VRK3) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Human Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT

ELI-17460h 96 Tests
EUR 824

VRK3 Vaccinia Related Kinase 3 Human Recombinant Protein

PROTQ8IV63 Regular: 10ug
EUR 317
Description: VRK3 Human Recombinant produced in E. coli is a single polypeptide chain containing 497 amino acids (1-474) and having a molecular mass of 55.3 kDa.;VRK3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)

KTE60047-48T 48T
EUR 332
  • Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)

KTE60047-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)

KTE60047-96T 96T
EUR 539
  • Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Serine/threonine- protein kinase VRK1, Vrk1 ELISA KIT

ELI-16975m 96 Tests
EUR 865

Mouse Serine/threonine-protein kinase VRK1 (VRK1) ELISA Kit

abx390835-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Bovine Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT

ELI-35280b 96 Tests
EUR 928

Vrk1 ELISA Kit| Mouse Serine/threonine-protein kinase VRK1 ELIS

EF016479 96 Tests
EUR 689

VRK1 ELISA Kit| Bovine Serine/threonine-protein kinase VRK1 ELI

EF012014 96 Tests
EUR 689

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 55.2 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in E.coli

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)

  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 53.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in Yeast

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx037186-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx033380-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx033380-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

abx034922-100ul 100 ul
EUR 523
  • Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody

  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.


EF005692 96 Tests
EUR 689

VRK1 ELISA Kit (Human) (OKCD00339)

OKCD00339 96 Wells
EUR 831
Description: Description of target: Serine/threonine kinase involved in Golgi disassembly during the cell cycle: following phosphorylation by PLK3 during mitosis, required to induce Golgi fragmentation. Acts by mediating phosphorylation of downstream target protein. Phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Phosphorylates casein and histone H3. Phosphorylates BANF1: disrupts its ability to bind DNA, reduces its binding to LEM domain-containing proteins and causes its relocalization from the nucleus to the cytoplasm. Phosphorylates ATF2 which activates its transcriptional activity.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein."_x005F_x005F_x000D_Lopez-Borges S., Lazo P.A._x005F_x005F_x000D_Oncogene 19:3656-3664(2000) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, AUTOPHOSPHORYLATION, MUTAGENESIS OF SER-14; THR-102; SER-125; SER-150; SER-158; SER-239; THR-305; THR-312; THR-355 AND THR-390.Ref.5"Characterization of three paralogous members of the Mammalian vaccinia related kinase family."_x005F_x005F_x000D_Nichols R.J., Traktman P._x005F_x005F_x000D_J. Biol. Chem. 279:7934-7946(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, PHOSPHORYLATION.Ref.6"Human vaccinia-related kinase 1 (VRK1) activates the ATF2 transcriptional activity by novel phosphorylation on Thr-73 and Ser-62 and cooperates with JNK."_x005F_x005F_x000D_Sevilla A., Santos C.R., Vega F.M., Lazo P.A._x005F_x005F_x000D_J. Biol. Chem. 279:27458-27465(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.8"The vaccinia-related kinases phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the nucleus."_x005F_x005F_x000D_Nichols R.J., Wiebe M.S., Traktman P._x005F_x005F_x000D_Mol. Biol. Cell 17:2451-2464(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.9"Proteomics identification of nuclear Ran GTPase as an inhibitor of human VRK1 and VRK2 (vaccinia-related kinase) activities."_x005F_x005F_x000D_Sanz-Garcia M., Lopez-Sanchez I., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Proteomics 7:2199-2214(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH RAN, ENZYME REGULATION.Ref.11"Plk3 interacts with and specifically phosphorylates VRK1 in Ser342, a downstream target in a pathway that induces Golgi fragmentation."_x005F_x005F_x000D_Lopez-Sanchez I., Sanz-Garcia M., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Biol. 29:1189-1201(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, PHOSPHORYLATION AT SER-342, MUTAGENESIS OF LYS-179 AND SER-342. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

VRK1 ELISA Kit (Human) (OKDD00592)

OKDD00592 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Human Fyn Related Kinase (FRK) ELISA Kit

abx387420-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Haptoglobin-Related Protein (HPR) AssayMax ELISA Kit

EH2233-1 96 Well Plate
EUR 477

VRK1 Antibody

43595-100ul 100ul
EUR 252

VRK1 Antibody

  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VRK1. Recognizes VRK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

VRK1 Antibody

DF9892 200ul
EUR 304
Description: VRK1 Antibody detects endogenous levels of total VRK1.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VRK1 Antibody

ABD13310 100 ug
EUR 438

VRK1 Antibody

ABD9892 100 ug
EUR 438


YF-PA15288 50 ug
EUR 363
Description: Mouse polyclonal to VRK1


YF-PA15289 100 ul
EUR 403
Description: Rabbit polyclonal to VRK1


YF-PA15290 100 ug
EUR 403
Description: Rabbit polyclonal to VRK1


YF-PA24959 50 ul
EUR 334
Description: Mouse polyclonal to VRK1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Fyn Related Kinase (FRK) ELISA Kit

abx595754-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human VRK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ERK(ELK-Related Tyrosine Kinase) ELISA Kit

EH3010 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: P29323
  • Alias: ERK/Cek5/Drt/Hek5/Nuk/Qek2/Sek3/Tyro5/CAPB/DRTEphB2/EC 2.7.10/EC tyrosine kinase/EPH receptor B2/eph tyrosine kinase 3/EPH-like kinase 5/ephrin type-B receptor 2/EPHT3
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Nik- related protein kinase, NRK ELISA KIT

ELI-44856h 96 Tests
EUR 824

Human Nik-related protein kinase (NRK) ELISA Kit

abx385224-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human NIMA Related Kinase 11 (NEK11) ELISA Kit

abx381761-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human NIMA Related Kinase 3 (NEK3) ELISA Kit

abx381762-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human NIMA Related Kinase 9 (NEK9) ELISA Kit

abx381763-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Vaccinia virus antibody

20C-CR1239RP 1 ml
EUR 554
Description: Rabbit polyclonal Vaccinia virus antibody

Vaccinia Virus antibody

10-1522 100 ug
EUR 325
Description: Mouse monoclonal Vaccinia Virus antibody

Vaccinia Virus antibody

10-1523 100 ug
EUR 330
Description: Mouse monoclonal Vaccinia Virus antibody

Vaccinia virus antibody

20-VR69 1 mg
EUR 116
Description: Rabbit polyclonal Vaccinia virus antibody

Vaccinia Virus Antibody

abx022301-1mg 1 mg
EUR 1017
  • Shipped within 5-10 working days.

Vaccinia Virus Antibody

abx022303-1mg 1 mg
EUR 1017
  • Shipped within 5-10 working days.

Vaccinia Virus Antibody

abx022304-1mg 1 mg
EUR 1121
  • Shipped within 5-10 working days.

Recombivirus Human Anti-Vaccinia virus (VACV) IMV/Envelop protein/H3L/p35 IgG ELISA kit, 96 tests, Quantitative

AE-311160-1 1 kit
EUR 590

VRK1 sgRNA CRISPR Lentivector (Human) (Target 1)

K2620202 1.0 ug DNA
EUR 154

Human Fms Related Tyrosine Kinase 1 (VEGFR1) CLIA Kit

  • EUR 7911.00
  • EUR 4215.00
  • EUR 973.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

DKK1 Dickkopf-Related Protein 1 Human Recombinant Protein

PROTO94907-1 Regular: 20ug
EUR 317
Description: DKK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 258 amino acids (32-266 a.a) and having a molecular mass of 28.2kDa.;DKK1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Adenylate Kinase 4 (AK 4) AssayMax ELISA Kit

EA2501-1 96 Well Plate
EUR 477

Human Nucleoside Diphosphate Kinase D (NDPKD) AssayMax ELISA Kit

EN2010-1 96 Well Plate
EUR 417

Rat Fyn Related Kinase (FRK) ELISA Kit

abx391362-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

NIMA Related Kinase 9 (NEK9) ELISA Kit

abx595418-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse Fyn Related Kinase (FRK) ELISA Kit

abx389359-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human CellExp? Vaccinia Virus B18R

EUR 381

VRK1 Blocking Peptide

DF9892-BP 1mg
EUR 195

VRK1 Conjugated Antibody

C43595 100ul
EUR 397

VRK1 cloning plasmid

CSB-CL857466HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1191
  • Sequence: atgcctcgtgtaaaagcagctcaagctggaagacagagctctgcaaagagacatcttgcagaacaatttgcagttggagagataataactgacatggcaaaaaaggaatggaaagtaggattacccattggccaaggaggctttggctgtatatatcttgctgatatgaattctt
  • Show more
Description: A cloning plasmid for the VRK1 gene.

VRK1 Rabbit pAb

A7745-100ul 100 ul
EUR 308

VRK1 Rabbit pAb

A7745-200ul 200 ul
EUR 459

VRK1 Rabbit pAb

A7745-20ul 20 ul
EUR 183

VRK1 Rabbit pAb

A7745-50ul 50 ul
EUR 223

VRK1 Polyclonal Antibody

ABP60902-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody

ABP60902-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody

ABP60902-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human VRK1 protein
  • Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody

ES10218-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VRK1 Polyclonal Antibody

ES10218-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-VRK1 Antibody

PB9907 100ug/vial
EUR 294

Anti-VRK1 antibody

STJ11100814 100 µl
EUR 413
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody

STJ110056 100 µl
EUR 277
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody

STJ191376 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to VRK1

Anti-VRK1 (4F9)

YF-MA16064 100 ug
EUR 363
Description: Mouse monoclonal to VRK1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Human STE20-Related Kinase Adaptor Beta (STRADB) ELISA Kit

abx383540-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit

abx387391-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human p21-Activated Kinase 4 (PAK-4) AssayMax ELISA Kit

EP3201-1 96 Well Plate
EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

VRK1 ORF Vector (Human) (pORF)

ORF035819 1.0 ug DNA
EUR 405

NIMA Related Kinase 1 (NEK1) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

NIMA Related Kinase 1 (NEK1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

GUK1 Human, Guanylate Kinase 1 Human Recombinant Protein, Active

PROTQ16774-1 Regular: 10ug
EUR 317
Description: GUK1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 217 amino acids (1-197 a.a.)and having a total molecular mass of 23.9 kDa. ;GUK1 is fused to a 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques.

CDK1 Cyclin-Dependent Kinase 1 Human Recombinant Protein

PROTP06493-1 Regular: 20ug
EUR 317
Description: CDK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 317 amino acids (1-297 a.a) and having a molecular mass of 36.2kDa. CDK1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.


AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Vaccinia Virus TV43 antibody

10R-V100a 1 mg
EUR 732
Description: Mouse monoclonal Vaccinia Virus TV43 antibody

Vaccinia Virus TV46 antibody

10R-V100b 1 mg
EUR 732
Description: Mouse monoclonal Vaccinia Virus TV46 antibody

Rabbit anti-Vaccinia antiserum

01-0003 250uL
EUR 451
  • Related to: Other Viruses
  • Applications: ELISA, WB

Vaccinia virus antibody (FITC)

60-V68 1 ml
EUR 392
Description: Rabbit polyclonal Vaccinia virus antibody (FITC) conjugated

Vaccinia virus antibody (HRP)

60-V69 1 ml
EUR 408
Description: Rabbit polyclonal Vaccinia virus antibody (HRP) conjugated

Vaccinia Virus (VACV) Antibody

abx411671-1ml 1 ml
EUR 606
  • Shipped within 1 week.

Vaccinia Virus (VACV) Antibody

abx414624-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Nrk ELISA Kit| Mouse Nik-related protein kinase ELISA Kit

EF015695 96 Tests
EUR 689

Mouse Nik- related protein kinase, Nrk ELISA KIT

ELI-13751m 96 Tests
EUR 865

Mouse Nik-related protein kinase (NRK) ELISA Kit

abx390056-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human MAP4K1(MEK Kinase Kinase 1)ELISA Kit

EH9949 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MEK Kinase Kinase 1 (MAP4K1) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit

E01S0416-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit

E01S0416-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit

E01S0416-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FLT3LG/ Fms-related tyrosine kinase 3 ligand ELISA Kit

E0927Hu 1 Kit
EUR 537

ELISA kit for Human Fms-related tyrosine kinase 3 ligand

EK1088 96 tests
EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Fms-related tyrosine kinase 3 ligand in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SPS1/STE20- related protein kinase YSK4, YSK4 ELISA KIT

ELI-28798h 96 Tests
EUR 824

Human SNF-related serine/threonine-protein kinase (SNRK) ELISA Kit

abx385418-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

MAPK1 Mitogen-Activated Protein Kinase 1 Human Recombinant Protein

PROTP28482-1 Regular: 10ug
EUR 317
Description: MAPK1 Recombinant (extracellular signal-regulated kinase) a Mitogen-Activated Protein Kinase, is a highly active form produced by phosphorylation of the purified ERK2/MAPK1 in vitro with MEK1 is a non-glycosylated polypeptide having a molecular mass of 44.6 kDa. _x000D_ MAPK1 is purified by proprietary chromatographic techniques._x000D_

Mouse Fms Related Tyrosine Kinase 1 (VEGFR1) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse VRK1 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal VRK1 Antibody (Center)

APR05905G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VRK1 (Center). This antibody is tested and proven to work in the following applications:

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

SUMO1 Small Ubiquitin-Related Modifier 1 Human Recombinant Protein, His Tag

PROTP63165-1 Regular: 20ug
EUR 317
Description: SUMO1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 109 amino acids (1-101) and having a molecular mass of 12.6 kDa.;SUMO1 is fused to a 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

Aurora/IPL1-Related Kinase 1 (ARK-1) Antibody

abx018156-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

Human VRK1(Vaccinia Related Kinase 1) ELISA Kit