Human VRK1(Vaccinia Related Kinase 1) ELISA Kit

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
RD-VRK1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
RD-VRK1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Vaccinia Related Kinase 1 (VRK1)ELISA Kit
201-12-2457	SunredBio	96 tests	EUR 440
This Vaccinia Related Kinase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
20-abx153490	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Vaccinia Related Kinase 1(VRK1)ELISA Kit
QY-E02017	Qayee Biotechnology	96T	EUR 361

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
SEC600Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
SEC600Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
SEC600Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
SEC600Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Vaccinia Related Kinase 1 (VRK1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV< Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Vaccinia Related Kinase 1 (VRK1) in serum, plasma and other biological fluids.

Human Vaccinia Related Kinase 1 (VRK1) ELISA Kit
4-SEC600Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Vaccinia Related Kinase 1 elisa. Alternative names of the recognized antigen: Serine/threonine-protein kinase VRK1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Vaccinia Related Kinase 1 (VRK1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Vaccinia Related Kinase 1 (VRK1) Antibody
20-abx102584	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Vaccinia Related Kinase 1 (VRK1) Antibody
20-abx175051	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Vaccinia Related Kinase 1 (VRK1)
4-RPC600Hu01	Cloud-Clone	EUR 501.41 EUR 237.00 EUR 1605.28 EUR 601.76 EUR 1103.52 EUR 398.00 EUR 3863.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99986 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 29.9kDa Isoelectric Point: Inquire
Description: Recombinant Human Vaccinia Related Kinase 1 expressed in: E.coli

Human Vaccinia Related Kinase 1 (VRK1) Protein
20-abx069616	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Rat Vaccinia Related Kinase 1(VRK1)ELISA Kit
QY-E10430	Qayee Biotechnology	96T	EUR 361

Mouse Vaccinia Related Kinase 1(VRK1)ELISA Kit
QY-E21577	Qayee Biotechnology	96T	EUR 361

Human Vaccinia Related Kinase 1 (VRK1) CLIA Kit
20-abx493787	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human VRK1 (Vaccinia Related Kinase 1)
ELK3275	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Vaccinia Related Kinase 1 (VRK1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to V Show more
Description: A sandwich ELISA kit for detection of Vaccinia Related Kinase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human)
4-PAC600Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1)

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC
4-PAC600Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Biotinylated
4-PAC600Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Biotin.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), Cy3
4-PAC600Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with Cy3.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), FITC
4-PAC600Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with FITC.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), HRP
4-PAC600Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with HRP.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), PE
4-PAC600Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with PE.

Vaccinia Related Kinase 1 (VRK1) Polyclonal Antibody (Human), APC-Cy7
4-PAC600Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: VRK1 (Gly46~Glu292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Vaccinia Related Kinase 1 (VRK1). This antibody is labeled with APC-Cy7.

Vaccinia Related Kinase 2 (VRK2) Antibody
20-abx116561	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Vaccinia Related Kinase 3 (VRK3) Antibody
20-abx116562	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT
ELI-17460h	Lifescience Market	96 Tests	EUR 824

VRK3 Vaccinia Related Kinase 3 Human Recombinant Protein
PROTQ8IV63	BosterBio	Regular: 10ug	EUR 317
Description: VRK3 Human Recombinant produced in E. coli is a single polypeptide chain containing 497 amino acids (1-474) and having a molecular mass of 55.3 kDa.;VRK3 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)
KTE60047-48T	Abbkine	48T	EUR 332
Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)
KTE60047-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Serine/threonine-protein kinase VRK1 (VRK1)
KTE60047-96T	Abbkine	96T	EUR 539
Serine/threonine-protein kinase VRK2 is an a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those Show more
Description: Quantitative sandwich ELISA for measuring Human Serine/threonine-protein kinase VRK1 (VRK1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Serine/threonine- protein kinase VRK1, Vrk1 ELISA KIT
ELI-16975m	Lifescience Market	96 Tests	EUR 865

Mouse Serine/threonine-protein kinase VRK1 (VRK1) ELISA Kit
abx390835-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Bovine Serine/threonine- protein kinase VRK1, VRK1 ELISA KIT
ELI-35280b	Lifescience Market	96 Tests	EUR 928

Vrk1 ELISA Kit| Mouse Serine/threonine-protein kinase VRK1 ELIS
EF016479	Lifescience Market	96 Tests	EUR 689

VRK1 ELISA Kit| Bovine Serine/threonine-protein kinase VRK1 ELI
EF012014	Lifescience Market	96 Tests	EUR 689

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)
1-CSB-EP768902MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 55.2 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in E.coli

Mouse Serine/threonine-protein kinase VRK1 (Vrk1)
1-CSB-YP768902MOb1	Cusabio	EUR 504.00 EUR 265.00 EUR 1832.00 EUR 763.00 EUR 1216.00 EUR 334.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 53.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Serine/threonine-protein kinase VRK1(Vrk1) expressed in Yeast

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
20-abx007048	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx037186-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
20-abx142305	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx033380-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx033380-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
abx034922-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Serine/threonine-Protein Kinase VRK1 (VRK1) Antibody
20-abx321912	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

VRK1 ELISA KIT|Human
EF005692	Lifescience Market	96 Tests	EUR 689

VRK1 ELISA Kit (Human) (OKCD00339)
OKCD00339	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Serine/threonine kinase involved in Golgi disassembly during the cell cycle: following phosphorylation by PLK3 during mitosis, required to induce Golgi fragmentation. Acts by mediating phosphorylation of downstream target protein. Phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Phosphorylates casein and histone H3. Phosphorylates BANF1: disrupts its ability to bind DNA, reduces its binding to LEM domain-containing proteins and causes its relocalization from the nucleus to the cytoplasm. Phosphorylates ATF2 which activates its transcriptional activity.6 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein."_x005F_x005F_x000D_Lopez-Borges S., Lazo P.A._x005F_x005F_x000D_Oncogene 19:3656-3664(2000) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, AUTOPHOSPHORYLATION, MUTAGENESIS OF SER-14; THR-102; SER-125; SER-150; SER-158; SER-239; THR-305; THR-312; THR-355 AND THR-390.Ref.5"Characterization of three paralogous members of the Mammalian vaccinia related kinase family."_x005F_x005F_x000D_Nichols R.J., Traktman P._x005F_x005F_x000D_J. Biol. Chem. 279:7934-7946(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, PHOSPHORYLATION.Ref.6"Human vaccinia-related kinase 1 (VRK1) activates the ATF2 transcriptional activity by novel phosphorylation on Thr-73 and Ser-62 and cooperates with JNK."_x005F_x005F_x000D_Sevilla A., Santos C.R., Vega F.M., Lazo P.A._x005F_x005F_x000D_J. Biol. Chem. 279:27458-27465(2004) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION.Ref.8"The vaccinia-related kinases phosphorylate the N' terminus of BAF, regulating its interaction with DNA and its retention in the nucleus."_x005F_x005F_x000D_Nichols R.J., Wiebe M.S., Traktman P._x005F_x005F_x000D_Mol. Biol. Cell 17:2451-2464(2006) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION.Ref.9"Proteomics identification of nuclear Ran GTPase as an inhibitor of human VRK1 and VRK2 (vaccinia-related kinase) activities."_x005F_x005F_x000D_Sanz-Garcia M., Lopez-Sanchez I., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Proteomics 7:2199-2214(2008) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, SUBCELLULAR LOCATION, INTERACTION WITH RAN, ENZYME REGULATION.Ref.11"Plk3 interacts with and specifically phosphorylates VRK1 in Ser342, a downstream target in a pathway that induces Golgi fragmentation."_x005F_x005F_x000D_Lopez-Sanchez I., Sanz-Garcia M., Lazo P.A._x005F_x005F_x000D_Mol. Cell. Biol. 29:1189-1201(2009) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, PHOSPHORYLATION AT SER-342, MUTAGENESIS OF LYS-179 AND SER-342. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.061 ng/mL

VRK1 ELISA Kit (Human) (OKDD00592)
OKDD00592	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.062 ng/mL

Human Fyn Related Kinase (FRK) ELISA Kit
abx387420-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Haptoglobin-Related Protein (HPR) AssayMax ELISA Kit
EH2233-1	AssayPro	96 Well Plate	EUR 477

VRK1 Antibody
43595-100ul	SAB	100ul	EUR 252

VRK1 Antibody
1-CSB-PA857466DSR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against VRK1. Recognizes VRK1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

VRK1 Antibody
DF9892	Affbiotech	200ul	EUR 304
Description: VRK1 Antibody detects endogenous levels of total VRK1.

VRK1 siRNA
20-abx939552	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VRK1 siRNA
20-abx939553	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

VRK1 Antibody
ABD13310	Lifescience Market	100 ug	EUR 438

VRK1 Antibody
ABD9892	Lifescience Market	100 ug	EUR 438

anti-VRK1
YF-PA15288	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to VRK1

anti-VRK1
YF-PA15289	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to VRK1

anti-VRK1
YF-PA15290	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to VRK1

anti-VRK1
YF-PA24959	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to VRK1

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Fyn Related Kinase (FRK) ELISA Kit
abx595754-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human VRK1 shRNA Plasmid
20-abx955093	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ERK(ELK-Related Tyrosine Kinase) ELISA Kit
EH3010	FN Test	96T	EUR 524.1
Detection range: 0.625-40 ng/ml Uniprot ID: P29323 Alias: ERK/Cek5/Drt/Hek5/Nuk/Qek2/Sek3/Tyro5/CAPB/DRTEphB2/EC 2.7.10/EC 2.7.10.1/EK5/elk-related tyrosine kinase/EPH receptor B2/eph tyrosine kinase 3/EPH-like kinase 5/ephrin type-B receptor 2/EPHT3 Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Nik- related protein kinase, NRK ELISA KIT
ELI-44856h	Lifescience Market	96 Tests	EUR 824

Human Nik-related protein kinase (NRK) ELISA Kit
abx385224-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human NIMA Related Kinase 11 (NEK11) ELISA Kit
abx381761-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human NIMA Related Kinase 3 (NEK3) ELISA Kit
abx381762-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human NIMA Related Kinase 9 (NEK9) ELISA Kit
abx381763-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Vaccinia virus antibody
20C-CR1239RP	Fitzgerald	1 ml	EUR 554
Description: Rabbit polyclonal Vaccinia virus antibody

Vaccinia Virus antibody
10-1522	Fitzgerald	100 ug	EUR 325
Description: Mouse monoclonal Vaccinia Virus antibody

Vaccinia Virus antibody
10-1523	Fitzgerald	100 ug	EUR 330
Description: Mouse monoclonal Vaccinia Virus antibody

Vaccinia virus antibody
20-VR69	Fitzgerald	1 mg	EUR 116
Description: Rabbit polyclonal Vaccinia virus antibody

Vaccinia Virus Antibody
abx022301-1mg	Abbexa	1 mg	EUR 1017
Shipped within 5-10 working days.

Vaccinia Virus Antibody
abx022303-1mg	Abbexa	1 mg	EUR 1017
Shipped within 5-10 working days.

Vaccinia Virus Antibody
abx022304-1mg	Abbexa	1 mg	EUR 1121
Shipped within 5-10 working days.

Recombivirus Human Anti-Vaccinia virus (VACV) IMV/Envelop protein/H3L/p35 IgG ELISA kit, 96 tests, Quantitative
AE-311160-1	Alpha Diagnostics	1 kit	EUR 590

VRK1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2620202	ABM	1.0 ug DNA	EUR 154

Human Fms Related Tyrosine Kinase 1 (VEGFR1) CLIA Kit
20-abx190165	Abbexa	EUR 7911.00 EUR 4215.00 EUR 973.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

DKK1 Dickkopf-Related Protein 1 Human Recombinant Protein
PROTO94907-1	BosterBio	Regular: 20ug	EUR 317
Description: DKK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 258 amino acids (32-266 a.a) and having a molecular mass of 28.2kDa.;DKK1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human Adenylate Kinase 4 (AK 4) AssayMax ELISA Kit
EA2501-1	AssayPro	96 Well Plate	EUR 477

Human Nucleoside Diphosphate Kinase D (NDPKD) AssayMax ELISA Kit
EN2010-1	AssayPro	96 Well Plate	EUR 417

Rat Fyn Related Kinase (FRK) ELISA Kit
abx391362-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

NIMA Related Kinase 9 (NEK9) ELISA Kit
abx595418-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Mouse Fyn Related Kinase (FRK) ELISA Kit
abx389359-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human CellExp? Vaccinia Virus B18R
8016-10	Biovision		EUR 381

VRK1 Blocking Peptide
DF9892-BP	Affbiotech	1mg	EUR 195

VRK1 Conjugated Antibody
C43595	SAB	100ul	EUR 397

VRK1 cloning plasmid
CSB-CL857466HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1191 Sequence: atgcctcgtgtaaaagcagctcaagctggaagacagagctctgcaaagagacatcttgcagaacaatttgcagttggagagataataactgacatggcaaaaaaggaatggaaagtaggattacccattggccaaggaggctttggctgtatatatcttgctgatatgaattctt Show more
Description: A cloning plasmid for the VRK1 gene.

VRK1 Rabbit pAb
A7745-100ul	Abclonal	100 ul	EUR 308

VRK1 Rabbit pAb
A7745-200ul	Abclonal	200 ul	EUR 459

VRK1 Rabbit pAb
A7745-20ul	Abclonal	20 ul	EUR 183

VRK1 Rabbit pAb
A7745-50ul	Abclonal	50 ul	EUR 223

VRK1 Polyclonal Antibody
ABP60902-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human VRK1 protein Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody
ABP60902-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human VRK1 protein Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody
ABP60902-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human VRK1 protein Applications tips:
Description: A polyclonal antibody for detection of VRK1 from Human, Mouse. This VRK1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human VRK1 protein

VRK1 Polyclonal Antibody
ES10218-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

VRK1 Polyclonal Antibody
ES10218-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VRK1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-VRK1 Antibody
PB9907	BosterBio	100ug/vial	EUR 294

Anti-VRK1 antibody
STJ11100814	St John's Laboratory	100 µl	EUR 413
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody
STJ110056	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. This gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. Its protein localizes to the nucleus and has been shown to promote the stability and nuclear accumulation of a transcriptionally active p53 molecule and, in vitro, to phosphorylate Thr18 of p53 and reduce p53 ubiquitination. This gene, therefore, may regulate cell proliferation. This protein also phosphorylates histone, casein, and the transcription factors ATF2 (activating transcription factor 2) and c-JUN.

Anti-VRK1 antibody
STJ191376	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to VRK1

Anti-VRK1 (4F9)
YF-MA16064	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to VRK1

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Human STE20-Related Kinase Adaptor Beta (STRADB) ELISA Kit
abx383540-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Fructosamine 3 Kinase Related Protein (FN3KRP) ELISA Kit
abx387391-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human p21-Activated Kinase 4 (PAK-4) AssayMax ELISA Kit
EP3201-1	AssayPro	96 Well Plate	EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

VRK1 ORF Vector (Human) (pORF)
ORF035819	ABM	1.0 ug DNA	EUR 405

NIMA Related Kinase 1 (NEK1) Antibody
20-abx212767	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

NIMA Related Kinase 1 (NEK1) Antibody
20-abx334225	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GUK1 Human, Guanylate Kinase 1 Human Recombinant Protein, Active
PROTQ16774-1	BosterBio	Regular: 10ug	EUR 317
Description: GUK1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 217 amino acids (1-197 a.a.)and having a total molecular mass of 23.9 kDa. ;GUK1 is fused to a 20 amino acid His Tag at N-terminus and is purified by proprietary chromatographic techniques.

CDK1 Cyclin-Dependent Kinase 1 Human Recombinant Protein
PROTP06493-1	BosterBio	Regular: 20ug	EUR 317
Description: CDK1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 317 amino acids (1-297 a.a) and having a molecular mass of 36.2kDa. CDK1 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Vaccinia Virus TV43 antibody
10R-V100a	Fitzgerald	1 mg	EUR 732
Description: Mouse monoclonal Vaccinia Virus TV43 antibody

Vaccinia Virus TV46 antibody
10R-V100b	Fitzgerald	1 mg	EUR 732
Description: Mouse monoclonal Vaccinia Virus TV46 antibody

Rabbit anti-Vaccinia antiserum
01-0003	IBT Bioservices	250uL	EUR 451
Description: Related to: Other Viruses Applications: ELISA, WB

Vaccinia virus antibody (FITC)
60-V68	Fitzgerald	1 ml	EUR 392
Description: Rabbit polyclonal Vaccinia virus antibody (FITC) conjugated

Vaccinia virus antibody (HRP)
60-V69	Fitzgerald	1 ml	EUR 408
Description: Rabbit polyclonal Vaccinia virus antibody (HRP) conjugated

Vaccinia Virus (VACV) Antibody
abx411671-1ml	Abbexa	1 ml	EUR 606
Shipped within 1 week.

Vaccinia Virus (VACV) Antibody
abx414624-02mg	Abbexa	0.2 mg	EUR 565
Shipped within 1 week.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Nrk ELISA Kit| Mouse Nik-related protein kinase ELISA Kit
EF015695	Lifescience Market	96 Tests	EUR 689

Mouse Nik- related protein kinase, Nrk ELISA KIT
ELI-13751m	Lifescience Market	96 Tests	EUR 865

Mouse Nik-related protein kinase (NRK) ELISA Kit
abx390056-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human MAP4K1(MEK Kinase Kinase 1)ELISA Kit
EH9949	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human MEK Kinase Kinase 1 (MAP4K1) ELISA Kit
20-abx388409	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-12 working days.

Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit
E01S0416-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit
E01S0416-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human STE20 related kinase adapter protein Alpha (STRADA) ELISA kit
E01S0416-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human STE20 related kinase adapter protein Alpha (STRADA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human FLT3LG/ Fms-related tyrosine kinase 3 ligand ELISA Kit
E0927Hu	Sunlong	1 Kit	EUR 537

ELISA kit for Human Fms-related tyrosine kinase 3 ligand
EK1088	SAB	96 tests	EUR 452
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Fms-related tyrosine kinase 3 ligand in samples from serum, plasma, tissue homogenates and other biological fluids.

Human SPS1/STE20- related protein kinase YSK4, YSK4 ELISA KIT
ELI-28798h	Lifescience Market	96 Tests	EUR 824

Human SNF-related serine/threonine-protein kinase (SNRK) ELISA Kit
abx385418-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

MAPK1 Mitogen-Activated Protein Kinase 1 Human Recombinant Protein
PROTP28482-1	BosterBio	Regular: 10ug	EUR 317
Description: MAPK1 Recombinant (extracellular signal-regulated kinase) a Mitogen-Activated Protein Kinase, is a highly active form produced by phosphorylation of the purified ERK2/MAPK1 in vitro with MEK1 is a non-glycosylated polypeptide having a molecular mass of 44.6 kDa. _x000D_ MAPK1 is purified by proprietary chromatographic techniques._x000D_

Mouse Fms Related Tyrosine Kinase 1 (VEGFR1) CLIA Kit
20-abx190478	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse VRK1 shRNA Plasmid
20-abx973379	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal VRK1 Antibody (Center)
APR05905G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human VRK1 (Center). This antibody is tested and proven to work in the following applications:

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

SUMO1 Small Ubiquitin-Related Modifier 1 Human Recombinant Protein, His Tag
PROTP63165-1	BosterBio	Regular: 20ug	EUR 317
Description: SUMO1 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 109 amino acids (1-101) and having a molecular mass of 12.6 kDa.;SUMO1 is fused to a 8 amino acid His-tag at C-terminus & purified by proprietary chromatographic techniques.

Aurora/IPL1-Related Kinase 1 (ARK-1) Antibody
abx018156-100ug	Abbexa	100 ug	EUR 384
Shipped within 5-10 working days.

Human VRK1(Vaccinia Related Kinase 1) ELISA Kit