Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit
Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
RD-TWSG1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
RD-TWSG1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody |
20-abx128102 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody |
20-abx174995 |
Abbexa |
|
|
|
Twisted Gastrulation Protein Homolog 1 (TWSG1) Antibody |
abx239120-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Twisted Gastrulation Protein Homolog 1 (TWSG1) |
4-RPF862Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9GZX9
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 25.8kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Twisted Gastrulation Protein Homolog 1 expressed in: E.coli |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1)ELISA Kit |
201-12-2425 |
SunredBio |
96 tests |
EUR 440 |
- This Twisted Gastrulation Protein Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
CSB-EL025361HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
1-CSB-EL025361HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E01T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E01T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E01T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
20-abx153413 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT |
ELI-28284h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit |
QY-E02014 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
SEF862Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- In
- Show more
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in Tissue homogenates and other biological fluids. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) ELISA Kit |
4-SEF862Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Twisted Gastrulation Protein Homolog 1 elisa. Alternative names of the recognized antigen: TSG
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Twisted Gastrulation Protein Homolog 1 (TWSG1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) Protein |
20-abx166022 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
CSB-EL025361MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1 (TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
1-CSB-EL025361MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E02T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E02T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E02T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E04T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E04T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E04T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E03T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E03T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E03T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E08T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E08T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E08T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E07T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E07T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E07T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E09T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E09T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E09T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E06T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E06T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E06T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Twisted gastrulation protein homolog 1, Twsg1 ELISA KIT |
ELI-23125m |
Lifescience Market |
96 Tests |
EUR 865 |
Chicken Twisted gastrulation protein homolog 1, TWSG1 ELISA KIT |
ELI-44811c |
Lifescience Market |
96 Tests |
EUR 928 |
Rat Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit |
QY-E10438 |
Qayee Biotechnology |
96T |
EUR 361 |
Mouse Twisted Gastrulation Protein Homolog 1(TWSG1)ELISA Kit |
QY-E21552 |
Qayee Biotechnology |
96T |
EUR 361 |
Human Twisted Gastrulation Protein Homolog 1 (TWSG1) CLIA Kit |
20-abx495028 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TWSG1 (Twisted Gastrulation Protein Homolog 1) |
ELK3568 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Twisted Gastrulation Protein Homolog 1 (TWSG1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody
- Show more
|
Description: A sandwich ELISA kit for detection of Twisted Gastrulation Protein Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1) |
KTE60114-48T |
Abbkine |
48T |
EUR 332 |
- The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1) |
KTE60114-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Twisted gastrulation protein homolog 1 (TWSG1) |
KTE60114-96T |
Abbkine |
96T |
EUR 539 |
- The cDNA encodes a protein sharing 41% amino acid identity with Drosophila Tsg, 89% identity with the partial human Tsg sequence, and 94% identity with a mouse EST. The Tsg sequence contains a signal peptide, as expected for a secreted protein, and 2
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Twisted gastrulation protein homolog 1 (TWSG1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human) |
4-PAF862Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1) |
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E05T0745-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E05T0745-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Twisted gastrulation protein homolog 1(TWSG1) ELISA kit |
E05T0745-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Twisted gastrulation protein homolog 1(TWSG1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC |
4-PAF862Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Biotinylated |
4-PAF862Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Biotin. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), Cy3 |
4-PAF862Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with Cy3. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), FITC |
4-PAF862Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with FITC. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), HRP |
4-PAF862Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with HRP. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), PE |
4-PAF862Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with PE. |
Twisted Gastrulation Protein Homolog 1 (TWSG1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF862Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: TWSG1 (Cys26~Phe223)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Twisted Gastrulation Protein Homolog 1 (TWSG1). This antibody is labeled with APC-Cy7. |
TSG Twisted Gastrulation Protein Human Recombinant Protein |
PROTQ9GZX9 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: TWSG1 Human Recombinant (26-223) produced in CHO is a single, glycosylated, polypeptide chain containing 198 amino acids and having a molecular mass ranging from 35-43kDa on SDS-PAGE due to glycosylation.;The TWSG1 is purified by proprietary chromatographic techniques. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
TWSG1 ELISA Kit (Human) (OKCD00986) |
OKCD00986 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL |
Recombinant Human TWSG1 Protein |
RP01049 |
Abclonal |
10 μg |
EUR 155 |
TWSG1 Recombinant Protein (Human) |
RP033538 |
ABM |
100 ug |
Ask for price |
TWSG1 ELISA Kit (Mouse) (OKCA00932) |
OKCA00932 |
Aviva Systems Biology |
96 Wells |
EUR 833 |
Description: Description of target: May be involved in dorsoventral axis formation. Seems to antagonize BMP signaling by forming ternary complexes with CHRD and BMPs, thereby preventing BMPs from binding to their receptors. In addition to the anti-BMP function, also has pro-BMP activity, partly mediated by cleavage and degradation of CHRD, which releases BMPs from ternary complexes. May be an important modulator of BMP-regulated cartilage development and chondrocyte differentiation. May play a role in thymocyte development.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL |
TWSG1 Antibody |
42983-100ul |
SAB |
100ul |
EUR 252 |
TWSG1 siRNA |
20-abx938631 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TWSG1 siRNA |
20-abx938632 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TWSG1 |
YF-PA26453 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to TWSG1 |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
TWSG1 Recombinant Protein (Rat) |
RP235358 |
ABM |
100 ug |
Ask for price |
TWSG1 Recombinant Protein (Mouse) |
RP182351 |
ABM |
100 ug |
Ask for price |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Human TWSG1 shRNA Plasmid |
20-abx961297 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human Protein pellino homolog 1 ELISA kit |
E01P0173-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein pellino homolog 1 ELISA kit |
E01P0173-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Protein pellino homolog 1 ELISA kit |
E01P0173-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Protein pellino homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
TWSG1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2562802 |
ABM |
1.0 ug DNA |
EUR 154 |
TWSG1 Conjugated Antibody |
C42983 |
SAB |
100ul |
EUR 397 |
TWSG1 cloning plasmid |
CSB-CL863935HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 672
- Sequence: atgaagttacactatgttgctgtgcttactctagccatcctgatgttcctgacatggcttccagaatcactgagctgtaacaaagcactctgtgctagtgatgtgagcaaatgcctcattcaggagctctgccagtgccggccgggagaaggcaattgctcctgctgtaaggagtg
- Show more
|
Description: A cloning plasmid for the TWSG1 gene. |
anti- TWSG1 antibody |
FNab09120 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200-1:1000
- IHC: 1:20-1:200
- Immunogen: twisted gastrulation homolog 1
- Uniprot ID: Q9GZX9
- Gene ID: 57045
- Research Area: Neuroscience, Developmental biology
|
Description: Antibody raised against TWSG1 |
Human TWSG1(Twisted Gastrulation Protein Homolog 1) ELISA Kit