Human TNMD(Tenomodulin) ELISA Kit

Human TNMD(Tenomodulin) ELISA Kit

Human Tenomodulin (TNMD) ELISA Kit

RD-TNMD-Hu-96Tests 96 Tests
EUR 723

Human Tenomodulin(TNMD) ELISA kit

CSB-EL024007HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tenomodulin(TNMD) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tenomodulin (TNMD) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tenomodulin (TNMD) ELISA Kit

abx250350-96tests 96 tests
EUR 746
  • Shipped within 5-12 working days.

Human TNMD/ Tenomodulin ELISA Kit

E2556Hu 1 Kit
EUR 571

Human TNMD(Tenomodulin) ELISA Kit

EH1104 96T
EUR 567.6
  • Detection range: 0.312-20 ng/ml
  • Uniprot ID: Q9H2S6
  • Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Tenomodulin, TNMD ELISA KIT

ELI-03188h 96 Tests
EUR 824

Human Tenomodulin (TNMD) ELISA Kit

abx572549-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Tenomodulin(TNMD)ELISA Kit

QY-E02852 96T
EUR 361

Human Tenomodulin (TNMD) ELISA Kit

SEC798Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit

SEC798Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit

SEC798Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit

SEC798Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tenomodulin elisa. Alternative names of the recognized antigen: TEM
  • BRICD4
  • CHM1L
  • Myodulin
  • Tendin
  • Chondromodulin-1-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tenomodulin (TNMD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Tenomodulin(TNMD) ELISA kit

CSB-EL024007MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Tenomodulin(TNMD) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Tenomodulin (TNMD) ELISA Kit

abx256381-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tnmd/ Tenomodulin ELISA Kit

E0991Ra 1 Kit
EUR 571

Mouse Tenomodulin, Tnmd ELISA KIT

ELI-03189m 96 Tests
EUR 865

Mouse Tenomodulin (TNMD) ELISA Kit

abx514514-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Tnmd(Tenomodulin) ELISA Kit

ER0403 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q9ESC2
  • Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Tenomodulin (Tnmd)

  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 35.6 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in E.coli

Mouse Tenomodulin (Tnmd)

  • EUR 679.00
  • EUR 335.00
  • EUR 2172.00
  • EUR 1051.00
  • EUR 1442.00
  • EUR 435.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 34.1 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in Yeast

Tenomodulin (TNMD) Antibody

abx026953-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody

abx026953-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody

  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tenomodulin (TNMD) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tenomodulin (TNMD) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Human TNMD (Tenomodulin)

ELK3581 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tenomodulin (TNMD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tenomodulin (TN
  • Show more
Description: A sandwich ELISA kit for detection of Tenomodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)

KTE60192-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)

KTE60192-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)

KTE60192-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Tenomodulin (TNMD) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Tenomodulin (TNMD) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Rat Tenomodulin (TNMD)

KTE100063-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tenomodulin (TNMD)

KTE100063-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tenomodulin (TNMD)

KTE100063-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)

KTE70104-48T 48T
EUR 332
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)

KTE70104-5platesof96wells 5 plates of 96 wells
EUR 2115
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)

KTE70104-96T 96T
EUR 539
  • By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tnmd ELISA Kit| Rat Tenomodulin ELISA Kit

EF017252 96 Tests
EUR 689

Tenomodulin (TNMD) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tnmd/ Rat Tnmd ELISA Kit

ELI-03190r 96 Tests
EUR 886


ELA-E0989h 96 Tests
EUR 824


EF001697 96 Tests
EUR 689

ELISA kit for Human Tenomodulin

EK2501 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tenomodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

TNMD ELISA Kit (Human) (OKCD08258)

OKCD08258 96 Wells
EUR 975
Description: Description of target: TNMD is a single-pass type II membrane proteinPotential. It belongs to the chondromodulin-1 family and contains 1 BRICHOS domain. TNMD may be an angiogenesis inhibitor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL

Tenomodulin antibody

70R-6905 50 ug
EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the N terminal of TNMD

Tenomodulin antibody

70R-6317 50 ug
EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the middle region of TNMD

TNMD ELISA Kit (Mouse) (OKCA02464)

OKCA02464 96 Wells
EUR 846
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 2.34 pg/mL

TNMD ELISA Kit (Mouse) (OKEH05757)

OKEH05757 96 Wells
EUR 662
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

TNMD ELISA Kit (Rat) (OKEH04398)

OKEH04398 96 Wells
EUR 662
Description: Description of target: transmembrane protein; may be an angiogenesis inhibitor; may play a regulatory role in eye and skeletal muscle development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.089 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

TNMD Antibody

43641-100ul 100ul
EUR 252

TNMD Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Tenomodulin Blocking Peptide

33R-4477 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6905

Tenomodulin Blocking Peptide

33R-7661 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6317

Human TNMD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNMD Recombinant Protein (Human)

RP032482 100 ug Ask for price

TNMD Conjugated Antibody

C43641 100ul
EUR 397

TNMD cloning plasmid

CSB-CL024007HU-10ug 10ug
EUR 285
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 624
  • Sequence: atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaa
  • Show more
Description: A cloning plasmid for the TNMD gene.

TNMD Rabbit pAb

A17753-100ul 100 ul
EUR 308

TNMD Rabbit pAb

A17753-200ul 200 ul
EUR 459

TNMD Rabbit pAb

A17753-20ul 20 ul
EUR 183

TNMD Rabbit pAb

A17753-50ul 50 ul
EUR 223

Recombinant mouse Tnmd

P1421 100ug Ask for price
  • Uniprot ID: Q9EP64
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Tnmd

Anti-TNMD antibody

STJ119792 100 µl
EUR 277
Description: This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009]

TNMD ORF Vector (Human) (pORF)

ORF010828 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Polyclonal TNMD Antibody (Center)

APR03728G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNMD (Center). This antibody is tested and proven to work in the following applications:

Mouse TNMD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat TNMD shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TNMD Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNMD Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNMD Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TNMD Recombinant Protein (Rat)

RP234134 100 ug Ask for price

TNMD Recombinant Protein (Mouse)

RP180350 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

TNMD sgRNA CRISPR Lentivector set (Human)

K2419001 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Tnmd ORF Vector (Rat) (pORF)

ORF078046 1.0 ug DNA
EUR 506

Tnmd ORF Vector (Mouse) (pORF)

ORF060118 1.0 ug DNA
EUR 506

TNMD sgRNA CRISPR Lentivector (Human) (Target 1)

K2419002 1.0 ug DNA
EUR 154

TNMD sgRNA CRISPR Lentivector (Human) (Target 2)

K2419003 1.0 ug DNA
EUR 154

TNMD sgRNA CRISPR Lentivector (Human) (Target 3)

K2419004 1.0 ug DNA
EUR 154

TNMD Protein Vector (Human) (pPB-C-His)

PV043309 500 ng
EUR 329

TNMD Protein Vector (Human) (pPB-N-His)

PV043310 500 ng
EUR 329

TNMD Protein Vector (Human) (pPM-C-HA)

PV043311 500 ng
EUR 329

TNMD Protein Vector (Human) (pPM-C-His)

PV043312 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Human TNMD(Tenomodulin) ELISA Kit