Human TNMD(Tenomodulin) ELISA Kit

Human Tenomodulin (TNMD) ELISA Kit
RD-TNMD-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Tenomodulin(TNMD) ELISA kit
CSB-EL024007HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Tenomodulin(TNMD) ELISA kit
1-CSB-EL024007HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Tenomodulin (TNMD) ELISA Kit
20-abx153249	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Tenomodulin (TNMD) ELISA Kit
abx250350-96tests	Abbexa	96 tests	EUR 746
Shipped within 5-12 working days.

Human TNMD/ Tenomodulin ELISA Kit
E2556Hu	Sunlong	1 Kit	EUR 571

Human TNMD(Tenomodulin) ELISA Kit
EH1104	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q9H2S6 Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Tenomodulin, TNMD ELISA KIT
ELI-03188h	Lifescience Market	96 Tests	EUR 824

Human Tenomodulin (TNMD) ELISA Kit
abx572549-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Tenomodulin(TNMD)ELISA Kit
QY-E02852	Qayee Biotechnology	96T	EUR 361

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
SEC798Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tenomodulin (TNMD) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tenomodulin (TNMD) in Tissue homogenates, cell lysates and other biological fluids.

Human Tenomodulin (TNMD) ELISA Kit
4-SEC798Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Tenomodulin elisa. Alternative names of the recognized antigen: TEM BRICD4 CHM1-LIKE CHM1L Myodulin Tendin Chondromodulin-1-like protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tenomodulin (TNMD) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Tenomodulin(TNMD) ELISA kit
CSB-EL024007MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin (TNMD) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Tenomodulin(TNMD) ELISA kit
1-CSB-EL024007MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Tenomodulin(TNMD) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Tenomodulin (TNMD) ELISA Kit
abx256381-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Tnmd/ Tenomodulin ELISA Kit
E0991Ra	Sunlong	1 Kit	EUR 571

Mouse Tenomodulin, Tnmd ELISA KIT
ELI-03189m	Lifescience Market	96 Tests	EUR 865

Mouse Tenomodulin (TNMD) ELISA Kit
abx514514-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Tnmd(Tenomodulin) ELISA Kit
ER0403	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: Q9ESC2 Alias: TNMD(Tenomodulin)/UNQ771/CHM1L/TeM/hTeM/Tendin/Myodulin/Chondromodulin-1-like protein/Chondromodulin-I-like protein
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Tenomodulin (Tnmd)
1-CSB-EP024007MO	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 35.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in E.coli

Mouse Tenomodulin (Tnmd)
1-CSB-YP324007MO	Cusabio	EUR 679.00 EUR 335.00 EUR 2172.00 EUR 1051.00 EUR 1442.00 EUR 435.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 34.1 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Tenomodulin(Tnmd),partial expressed in Yeast

Tenomodulin (TNMD) Antibody
abx026953-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody
abx026953-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody
20-abx178548	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Tenomodulin (TNMD) Antibody
20-abx174740	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Tenomodulin (TNMD) Antibody
20-abx338730	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human TNMD (Tenomodulin)
ELK3581	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tenomodulin (TNMD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Tenomodulin (TN Show more
Description: A sandwich ELISA kit for detection of Tenomodulin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)
KTE60192-48T	Abbkine	48T	EUR 332
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)
KTE60192-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tenomodulin (TNMD)
KTE60192-96T	Abbkine	96T	EUR 539
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Human Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Tenomodulin (TNMD) CLIA Kit
20-abx493907	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Tenomodulin (TNMD) Protein
20-abx655206	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-48T	Abbkine	48T	EUR 332
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Tenomodulin (TNMD)
KTE100063-96T	Abbkine	96T	EUR 539
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Rat Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-48T	Abbkine	48T	EUR 332
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tenomodulin (TNMD)
KTE70104-96T	Abbkine	96T	EUR 539
By searching an EST database for sequences similar to mouse Tem, followed by RACE of a human fetus cDNA library, Shukunami et al. (2001) cloned TEM. The deduced 317-amino acid protein contains an N-terminal transmembrane domain and a putative antiang Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tenomodulin (TNMD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tnmd ELISA Kit| Rat Tenomodulin ELISA Kit
EF017252	Lifescience Market	96 Tests	EUR 689

Tenomodulin (TNMD) Antibody (HRP)
20-abx337925	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody (FITC)
20-abx337926	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tenomodulin (TNMD) Antibody (Biotin)
20-abx337927	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Tnmd/ Rat Tnmd ELISA Kit
ELI-03190r	Lifescience Market	96 Tests	EUR 886

Human TNMD ELISA Kit
ELA-E0989h	Lifescience Market	96 Tests	EUR 824

TNMD ELISA KIT|Human
EF001697	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Tenomodulin
EK2501	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Tenomodulin in samples from serum, plasma, tissue homogenates and other biological fluids.

TNMD ELISA Kit (Human) (OKCD08258)
OKCD08258	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: TNMD is a single-pass type II membrane proteinPotential. It belongs to the chondromodulin-1 family and contains 1 BRICHOS domain. TNMD may be an angiogenesis inhibitor.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.114ng/mL

Tenomodulin antibody
70R-6905	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the N terminal of TNMD

Tenomodulin antibody
70R-6317	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Tenomodulin antibody raised against the middle region of TNMD

TNMD ELISA Kit (Mouse) (OKCA02464)
OKCA02464	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 2.34 pg/mL

TNMD ELISA Kit (Mouse) (OKEH05757)
OKEH05757	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: May be an angiogenesis inhibitor. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL

TNMD ELISA Kit (Rat) (OKEH04398)
OKEH04398	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: transmembrane protein; may be an angiogenesis inhibitor; may play a regulatory role in eye and skeletal muscle development [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.089 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TNMD Antibody
43641-100ul	SAB	100ul	EUR 252

TNMD Antibody
1-CSB-PA024007LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

TNMD siRNA
20-abx905713	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TNMD siRNA
20-abx937662	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TNMD siRNA
20-abx937663	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Tenomodulin Blocking Peptide
33R-4477	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6905

Tenomodulin Blocking Peptide
33R-7661	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TNMD antibody, catalog no. 70R-6317

Human TNMD shRNA Plasmid
20-abx961920	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TNMD Recombinant Protein (Human)
RP032482	ABM	100 ug	Ask for price

TNMD Conjugated Antibody
C43641	SAB	100ul	EUR 397

TNMD cloning plasmid
CSB-CL024007HU-10ug	Cusabio	10ug	EUR 285
Formulation: 10 μg plasmid + 200μl Glycerol Length: 624 Sequence: atggcaaagaatcctccagagaattgtgaagactgtcacattctaaatgcagaagcttttaaatccaagaaaatatgtaaatcacttaagatttgtggactggtgtttggtatcctggccctaactctaattgtcctgttttgggggagcaagcacttctggccggaggtacccaa Show more
Description: A cloning plasmid for the TNMD gene.

TNMD Rabbit pAb
A17753-100ul	Abclonal	100 ul	EUR 308

TNMD Rabbit pAb
A17753-200ul	Abclonal	200 ul	EUR 459

TNMD Rabbit pAb
A17753-20ul	Abclonal	20 ul	EUR 183

TNMD Rabbit pAb
A17753-50ul	Abclonal	50 ul	EUR 223

Recombinant mouse Tnmd
P1421	FN Test	100ug	Ask for price
Uniprot ID: Q9EP64 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Tnmd

Anti-TNMD antibody
STJ119792	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a protein that is related to chondromodulin-I, which is a cartilage-specific glycoprotein that functions to stimulate chondrocyte growth and to inhibit tube formation of endothelial cells. This protein is also an angiogenesis inhibitor. Genetic variation in this gene is associated with a risk for type 2 diabetes, central obesity and serum levels of systemic immune mediators in a body size-dependent manner. This gene is also a candidate gene for age-related macular degeneration, though a direct link has yet to be demonstrated. [provided by RefSeq, Sep 2009]

TNMD ORF Vector (Human) (pORF)
ORF010828	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Polyclonal TNMD Antibody (Center)
APR03728G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TNMD (Center). This antibody is tested and proven to work in the following applications:

Mouse TNMD shRNA Plasmid
20-abx975257	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat TNMD shRNA Plasmid
20-abx986157	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TNMD Antibody, HRP conjugated
1-CSB-PA024007LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TNMD Antibody, FITC conjugated
1-CSB-PA024007LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TNMD Antibody, Biotin conjugated
1-CSB-PA024007LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TNMD. Recognizes TNMD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

TNMD Recombinant Protein (Rat)
RP234134	ABM	100 ug	Ask for price

TNMD Recombinant Protein (Mouse)
RP180350	ABM	100 ug	Ask for price

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

TNMD sgRNA CRISPR Lentivector set (Human)
K2419001	ABM	3 x 1.0 ug	EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Tnmd ORF Vector (Rat) (pORF)
ORF078046	ABM	1.0 ug DNA	EUR 506

Tnmd ORF Vector (Mouse) (pORF)
ORF060118	ABM	1.0 ug DNA	EUR 506

TNMD sgRNA CRISPR Lentivector (Human) (Target 1)
K2419002	ABM	1.0 ug DNA	EUR 154

TNMD sgRNA CRISPR Lentivector (Human) (Target 2)
K2419003	ABM	1.0 ug DNA	EUR 154

TNMD sgRNA CRISPR Lentivector (Human) (Target 3)
K2419004	ABM	1.0 ug DNA	EUR 154

TNMD Protein Vector (Human) (pPB-C-His)
PV043309	ABM	500 ng	EUR 329

TNMD Protein Vector (Human) (pPB-N-His)
PV043310	ABM	500 ng	EUR 329

TNMD Protein Vector (Human) (pPM-C-HA)
PV043311	ABM	500 ng	EUR 329

TNMD Protein Vector (Human) (pPM-C-His)
PV043312	ABM	500 ng	EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Human TNMD(Tenomodulin) ELISA Kit