Human TKT(Transketolase) ELISA Kit

Human TKT(Transketolase) ELISA Kit

Human Transketolase (TKT) ELISA Kit

RDR-TKT-Hu-48Tests 48 Tests
EUR 544

Human Transketolase (TKT) ELISA Kit

RDR-TKT-Hu-96Tests 96 Tests
EUR 756

Human Transketolase (TKT) ELISA Kit

RD-TKT-Hu-48Tests 48 Tests
EUR 521

Human Transketolase (TKT) ELISA Kit

RD-TKT-Hu-96Tests 96 Tests
EUR 723

Rat Transketolase (TKT) ELISA Kit

DLR-TKT-Ra-48T 48T
EUR 549
  • Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Transketolase (TKT) ELISA Kit

DLR-TKT-Ra-96T 96T
EUR 718
  • Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Transketolase (TKT) ELISA Kit

RDR-TKT-Ra-48Tests 48 Tests
EUR 583

Rat Transketolase (TKT) ELISA Kit

RDR-TKT-Ra-96Tests 96 Tests
EUR 811

Rat Transketolase (TKT) ELISA Kit

RD-TKT-Ra-48Tests 48 Tests
EUR 557

Rat Transketolase (TKT) ELISA Kit

RD-TKT-Ra-96Tests 96 Tests
EUR 775

Human Transketolase (TKT) ELISA Kit

abx570798-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human TKT/ Transketolase ELISA Kit

E2507Hu 1 Kit
EUR 571

Human Transketolase (TKT) ELISA Kit

20-abx153380
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transketolase ELISA Kit (TKT)

RK02393 96 Tests
EUR 521

Human Transketolase (TKT) ELISA Kit

SEH019Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

SEH019Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

SEH019Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

SEH019Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit

4-SEH019Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transketolase elisa. Alternative names of the recognized antigen: TK
  • Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transketolase (TKT)

1-CSB-EP023580HUe1
  • EUR 621.00
  • EUR 381.00
  • EUR 1943.00
  • EUR 882.00
  • EUR 1335.00
  • EUR 451.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 67.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transketolase(TKT) expressed in E.coli

Cow Transketolase (TKT) ELISA Kit

abx511828-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Transketolase (TKT) ELISA Kit

abx511830-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Transketolase (TKT) ELISA Kit

abx573626-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Bovine Transketolase, TKT ELISA Kit

ELA-E0113b 96 Tests
EUR 928

Mouse Transketolase, TKT ELISA Kit

ELA-E0113m 96 Tests
EUR 678

Rat Transketolase, TKT ELISA Kit

ELA-E0113r 96 Tests
EUR 678

Mouse Tkt/ Transketolase ELISA Kit

E1477Mo 1 Kit
EUR 571

Rat Transketolase (TKT) ELISA Kit

20-abx156184
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

SEH019Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit

4-SEH019Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transketolase elisa. Alternative names of the recognized antigen: TK
  • Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Transketolase (TKT) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human TKT (Transketolase)

ELK3271 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase
  • Show more
Description: A sandwich ELISA kit for detection of Transketolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transketolase (TKT) Antibody

20-abx116203
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

20-abx129192
  • EUR 314.00
  • EUR 133.00
  • EUR 815.00
  • EUR 425.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transketolase (TKT) Antibody

20-abx130403
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Transketolase (TKT) Antibody

abx122017-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

20-abx142264
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

20-abx004826
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

20-abx174907
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transketolase (TKT) Antibody

20-abx174908
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Transketolase (TKT) Antibody

abx238938-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Transketolase (TKT) Antibody

abx238939-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Transketolase (TKT) Antibody

20-abx241314
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Transketolase (TKT) Antibody

20-abx241315
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Transketolase (TKT)

4-RPH019Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P29401
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Transketolase expressed in: E.coli

Recombinant Transketolase (TKT)

4-RPH019Ra01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P50137
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.9kDa
  • Isoelectric Point: 7.1
Description: Recombinant Rat Transketolase expressed in: E.coli

Human Transketolase (TKT) CLIA Kit

20-abx495353
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Transketolase (TKT) Protein

20-abx166627
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rat TKT (Transketolase)

ELK7034 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase
  • Show more
Description: A sandwich ELISA kit for detection of Transketolase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)

KTE70217-48T 48T
EUR 332
  • Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)

KTE70217-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)

KTE70217-96T 96T
EUR 539
  • Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Transketolase (TKT) CLIA Kit

20-abx495354
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Transketolase (TKT) Protein

20-abx167617
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

TKT Transketolase Human Recombinant Protein

PROTP29401 Regular: 10ug
EUR 317
Description: TKT Human Recombinant produced in E. coli is a single polypeptide chain containing 643 amino acids (1-623) and having a molecular mass of 70.0kDa.;TKT is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Transketolase (TKT) Polyclonal Antibody (Human)

4-PAH019Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human), APC

4-PAH019Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human), Biotinylated

4-PAH019Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human), Cy3

4-PAH019Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human), FITC

4-PAH019Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human), HRP

4-PAH019Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human), PE

4-PAH019Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat)

4-PAH019Ra01
  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human), APC-Cy7

4-PAH019Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Pro294)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC-Cy7.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC

4-PAH019Ra01-APC
  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAH019Ra01-Biotin
  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Cy3

4-PAH019Ra01-Cy3
  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), FITC

4-PAH019Ra01-FITC
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), HRP

4-PAH019Ra01-HRP
  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), PE

4-PAH019Ra01-PE
  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAH019Ra01-APC-Cy7
  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: TKT (Met1~Lys286)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC-Cy7.

Human Transketolase ELISA kit

E01T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit

E01T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit

E01T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA Kit

ELA-E0113h 96 Tests
EUR 824

Transketolase ELISA KIT|Human

EF003792 96 Tests
EUR 689

TKT ELISA Kit (Human) (OKAN05459)

OKAN05459 96 Wells
EUR 792
Description: Description of target: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071 ng/mL

TKT ELISA Kit (Human) (OKCD09022)

OKCD09022 96 Wells
EUR 975
Description: Description of target: TKT belongs to the transketolase family. TKT has been implicated in the latent genetic disease Wernicke-Korsakoff syndrome (WKS), which causes specific brain damage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.071ng/mL

TKT ELISA Kit (Human) (OKEH03030)

OKEH03030 96 Wells
EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Mouse Transketolase ELISA kit

E03T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit

E03T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit

E03T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit

E02T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit

E02T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit

E02T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit

E04T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit

E04T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit

E04T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit

E08T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit

E08T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit

E08T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit

E07T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit

E07T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit

E07T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit

E06T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit

E06T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit

E06T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit

E09T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit

E09T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit

E09T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit

E05T0759-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit

E05T0759-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit

E05T0759-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TKT ELISA Kit (Rat) (OKCD00704)

OKCD00704 96 Wells
EUR 896
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

TKT ELISA Kit (Mouse) (OKEH05920)

OKEH05920 96 Wells
EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

TKT ELISA Kit (Bovine) (OKEH07303)

OKEH07303 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

anti-Transketolase

YF-PA15046 50 ug
EUR 363
Description: Mouse polyclonal to Transketolase

anti-Transketolase

YF-PA15047 100 ul
EUR 403
Description: Rabbit polyclonal to Transketolase

anti-Transketolase

YF-PA15048 100 ug
EUR 403
Description: Rabbit polyclonal to Transketolase

TKT siRNA

20-abx905591
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TKT siRNA

20-abx936854
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TKT siRNA

20-abx936855
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TKT antibody

70R-20843 50 ul
EUR 435
Description: Rabbit polyclonal TKT antibody

TKT antibody

70R-2587 50 ug
EUR 467
Description: Rabbit polyclonal TKT antibody

TKT antibody

38817-100ul 100ul
EUR 252

TKT Antibody

42786-100ul 100ul
EUR 252

TKT antibody

10R-6070 100 ul
EUR 726
Description: Mouse monoclonal TKT antibody

TKT Antibody

1-CSB-PA570820
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TKT Antibody

1-CSB-PA023580GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TKT Antibody

1-CSB-PA025245
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Human Transketolase- like protein 1, TKTL1 ELISA KIT

ELI-16212h 96 Tests
EUR 824

Human Transketolase- like protein 2, TKTL2 ELISA KIT

ELI-41847h 96 Tests
EUR 824

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

20-abx153312
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Transketolase-like protein 2 (TKTL2) ELISA Kit

abx385487-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

DLR-TKTL1-Hu-48T 48T
EUR 517
  • Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

DLR-TKTL1-Hu-96T 96T
EUR 673
  • Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RDR-TKTL1-Hu-48Tests 48 Tests
EUR 544

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RDR-TKTL1-Hu-96Tests 96 Tests
EUR 756

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RD-TKTL1-Hu-48Tests 48 Tests
EUR 521

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

RD-TKTL1-Hu-96Tests 96 Tests
EUR 723

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

SEH018Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit

4-SEH018Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Transketolase Like Protein 1 elisa. Alternative names of the recognized antigen: TKR
  • TKT2
  • TK 2
  • Transketolase-related protein
  • Transketolase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human TKT shRNA Plasmid

20-abx954853
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

TKT Recombinant Protein (Human)

RP031648 100 ug Ask for price

TKT Recombinant Protein (Human)

RP031651 100 ug Ask for price

anti- Transketolase antibody

FNab08938 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: transketolase
  • Uniprot ID: P29401
  • Gene ID: 7086
  • Research Area: Metabolism
Description: Antibody raised against Transketolase

anti- Transketolase antibody

FNab08939 100µg
EUR 585
  • Recommended dilution: WB: 1:500-1:5000
  • IHC: 1:20-1:200
  • IF: 1:20-1:200
  • Immunogen: transketolase
  • Uniprot ID: P29401
  • Gene ID: 7086
  • Research Area: Metabolism
Description: Antibody raised against Transketolase

Recombinant mouse Transketolase

P1406 100ug Ask for price
  • Uniprot ID: P40142
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Transketolase

Anti-Transketolase antibody

PAab08938 100 ug
EUR 386

ELISA kit for Human TKTL1 (Transketolase Like Protein 1)

ELK4675 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase Like Protein 1 (TKTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Transketolase Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

TKT Conjugated Antibody

C38817 100ul
EUR 397

TKT cloning plasmid

CSB-CL023580HU1-10ug 10ug
EUR 633
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1872
  • Sequence: atggagagctaccacaagcctgaccagcagaagctgcaggccttgaaggacacggccaaccgcctacgtatcagctccatccaggccaccactgcggcgggctctggccaccccacgtcatgctgcagcgccgcagagatcatggctgtcctctttttccacaccatgcgctaca
  • Show more
Description: A cloning plasmid for the TKT gene.

TKT cloning plasmid

CSB-CL023580HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1374
  • Sequence: atggccttcgccagcatctataagctggacaaccttgtggccattctagacatcaatcgcctgggccagagtgacccggccccgctgcagcaccagatggacatctaccagaagcggtgcgaggccttcggttggcatgccatcatcgtggatggacacagcgtggaggagctgt
  • Show more
Description: A cloning plasmid for the TKT gene.

TKT Polyclonal Antibody

ES11750-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

TKT Polyclonal Antibody

ES11750-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human TKT(Transketolase) ELISA Kit