Human TKT(Transketolase) ELISA Kit

Human Transketolase (TKT) ELISA Kit
RDR-TKT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Transketolase (TKT) ELISA Kit
RDR-TKT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Transketolase (TKT) ELISA Kit
RD-TKT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Transketolase (TKT) ELISA Kit
RD-TKT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Rat Transketolase (TKT) ELISA Kit
DLR-TKT-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Transketolase (TKT) ELISA Kit
DLR-TKT-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Transketolase (TKT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Transketolase (TKT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Transketolase (TKT) ELISA Kit
RDR-TKT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Transketolase (TKT) ELISA Kit
RDR-TKT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Transketolase (TKT) ELISA Kit
RD-TKT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Transketolase (TKT) ELISA Kit
RD-TKT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Transketolase (TKT) ELISA Kit
abx570798-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human TKT/ Transketolase ELISA Kit
E2507Hu	Sunlong	1 Kit	EUR 571

Human Transketolase (TKT) ELISA Kit
20-abx153380	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transketolase ELISA Kit (TKT)
RK02393	Abclonal	96 Tests	EUR 521

Human Transketolase (TKT) ELISA Kit
SEH019Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
SEH019Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
SEH019Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
SEH019Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Human Transketolase (TKT) ELISA Kit
4-SEH019Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transketolase elisa. Alternative names of the recognized antigen: TK Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase (TKT) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Transketolase (TKT)
1-CSB-EP023580HUe1	Cusabio	EUR 621.00 EUR 381.00 EUR 1943.00 EUR 882.00 EUR 1335.00 EUR 451.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 67.9 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Transketolase(TKT) expressed in E.coli

Cow Transketolase (TKT) ELISA Kit
abx511828-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Transketolase (TKT) ELISA Kit
abx511830-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Transketolase (TKT) ELISA Kit
abx573626-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Bovine Transketolase, TKT ELISA Kit
ELA-E0113b	Lifescience Market	96 Tests	EUR 928

Mouse Transketolase, TKT ELISA Kit
ELA-E0113m	Lifescience Market	96 Tests	EUR 678

Rat Transketolase, TKT ELISA Kit
ELA-E0113r	Lifescience Market	96 Tests	EUR 678

Mouse Tkt/ Transketolase ELISA Kit
E1477Mo	Sunlong	1 Kit	EUR 571

Rat Transketolase (TKT) ELISA Kit
20-abx156184	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
SEH019Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Transketolase (TKT) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Transketolase (TKT) in serum, plasma, tissue homogenates and other biological fluids.

Rat Transketolase (TKT) ELISA Kit
4-SEH019Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transketolase elisa. Alternative names of the recognized antigen: TK Wernicke-Korsakoff Syndrome
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Transketolase (TKT) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human TKT (Transketolase)
ELK3271	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase Show more
Description: A sandwich ELISA kit for detection of Transketolase from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Transketolase (TKT) Antibody
20-abx116203	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx129192	Abbexa	EUR 314.00 EUR 133.00 EUR 815.00 EUR 425.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transketolase (TKT) Antibody
20-abx130403	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Transketolase (TKT) Antibody
abx122017-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx142264	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx004826	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx174907	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Transketolase (TKT) Antibody
20-abx174908	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Transketolase (TKT) Antibody
abx238938-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Transketolase (TKT) Antibody
abx238939-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Transketolase (TKT) Antibody
20-abx241314	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Transketolase (TKT) Antibody
20-abx241315	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Transketolase (TKT)
4-RPH019Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P29401 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 36.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Transketolase expressed in: E.coli

Recombinant Transketolase (TKT)
4-RPH019Ra01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P50137 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.9kDa Isoelectric Point: 7.1
Description: Recombinant Rat Transketolase expressed in: E.coli

Human Transketolase (TKT) CLIA Kit
20-abx495353	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Transketolase (TKT) Protein
20-abx166627	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Rat TKT (Transketolase)
ELK7034	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase (TKT). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Transketolase Show more
Description: A sandwich ELISA kit for detection of Transketolase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)
KTE70217-48T	Abbkine	48T	EUR 332
Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)
KTE70217-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Transketolase (TKT)
KTE70217-96T	Abbkine	96T	EUR 539
Transketolase (EC 2.2.1.1) is a thiamine-dependent enzyme that links the pentose phosphate pathway with the glycolytic pathway. The pentose phosphate pathway, which is active in most tissues, provides sugar phosphates for intermediary biosynthesis, e Show more
Description: Quantitative sandwich ELISA for measuring Mouse Transketolase (TKT) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Transketolase (TKT) CLIA Kit
20-abx495354	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Transketolase (TKT) Protein
20-abx167617	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

TKT Transketolase Human Recombinant Protein
PROTP29401	BosterBio	Regular: 10ug	EUR 317
Description: TKT Human Recombinant produced in E. coli is a single polypeptide chain containing 643 amino acids (1-623) and having a molecular mass of 70.0kDa.;TKT is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Transketolase (TKT) Polyclonal Antibody (Human)
4-PAH019Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human), APC
4-PAH019Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human), Biotinylated
4-PAH019Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human), Cy3
4-PAH019Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human), FITC
4-PAH019Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human), HRP
4-PAH019Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human), PE
4-PAH019Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat)
4-PAH019Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT)

Transketolase (TKT) Polyclonal Antibody (Human), APC-Cy7
4-PAH019Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Pro294) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human Transketolase (TKT). This antibody is labeled with APC-Cy7.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC
4-PAH019Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAH019Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Biotin.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), Cy3
4-PAH019Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with Cy3.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), FITC
4-PAH019Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with FITC.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), HRP
4-PAH019Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with HRP.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), PE
4-PAH019Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with PE.

Transketolase (TKT) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAH019Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TKT (Met1~Lys286) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Transketolase (TKT). This antibody is labeled with APC-Cy7.

Human Transketolase ELISA kit
E01T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA kit
E01T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Transketolase ELISA Kit
ELA-E0113h	Lifescience Market	96 Tests	EUR 824

Transketolase ELISA KIT|Human
EF003792	Lifescience Market	96 Tests	EUR 689

TKT ELISA Kit (Human) (OKAN05459)
OKAN05459	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a thiamine-dependent enzyme which plays a role in the channeling of excess sugar phosphates to glycolysis in the pentose phosphate pathway. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.071 ng/mL

TKT ELISA Kit (Human) (OKCD09022)
OKCD09022	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: TKT belongs to the transketolase family. TKT has been implicated in the latent genetic disease Wernicke-Korsakoff syndrome (WKS), which causes specific brain damage.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.071ng/mL

TKT ELISA Kit (Human) (OKEH03030)
OKEH03030	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Mouse Transketolase ELISA kit
E03T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit
E03T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Transketolase ELISA kit
E03T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit
E02T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit
E02T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Transketolase ELISA kit
E02T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit
E04T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit
E04T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Transketolase ELISA kit
E04T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit
E08T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit
E08T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Transketolase ELISA kit
E08T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit
E07T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit
E07T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Transketolase ELISA kit
E07T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit
E06T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit
E06T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Transketolase ELISA kit
E06T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit
E09T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit
E09T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Transketolase ELISA kit
E09T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit
E05T0759-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit
E05T0759-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Transketolase ELISA kit
E05T0759-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Transketolase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

TKT ELISA Kit (Rat) (OKCD00704)
OKCD00704	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.63 ng/mL

TKT ELISA Kit (Mouse) (OKEH05920)
OKEH05920	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Catalyzes the transfer of a two-carbon ketol group from a ketose donor to an aldose acceptor, via a covalent intermediate with the cofactor thiamine pyrophosphate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

TKT ELISA Kit (Bovine) (OKEH07303)
OKEH07303	Aviva Systems Biology	96 Wells	EUR 1092
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

anti-Transketolase
YF-PA15046	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Transketolase

anti-Transketolase
YF-PA15047	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to Transketolase

anti-Transketolase
YF-PA15048	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Transketolase

TKT siRNA
20-abx905591	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TKT siRNA
20-abx936854	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TKT siRNA
20-abx936855	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TKT antibody
70R-20843	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TKT antibody

TKT antibody
70R-2587	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal TKT antibody

TKT antibody
38817-100ul	SAB	100ul	EUR 252

TKT Antibody
42786-100ul	SAB	100ul	EUR 252

TKT antibody
10R-6070	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal TKT antibody

TKT Antibody
1-CSB-PA570820	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TKT Antibody
1-CSB-PA023580GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

TKT Antibody
1-CSB-PA025245	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TKT. Recognizes TKT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

Human Transketolase- like protein 1, TKTL1 ELISA KIT
ELI-16212h	Lifescience Market	96 Tests	EUR 824

Human Transketolase- like protein 2, TKTL2 ELISA KIT
ELI-41847h	Lifescience Market	96 Tests	EUR 824

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
20-abx153312	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Transketolase-like protein 2 (TKTL2) ELISA Kit
abx385487-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
DLR-TKTL1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
DLR-TKTL1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Transketolase Like Protein 1 (TKTL1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RDR-TKTL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RDR-TKTL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RD-TKTL1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
RD-TKTL1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
SEH018Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Transketolase Like Protein 1 (TKTL1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Transketolase Like Protein 1 (TKTL1) in Tissue homogenates, cell lysates and other biological fluids.

Human Transketolase Like Protein 1 (TKTL1) ELISA Kit
4-SEH018Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Transketolase Like Protein 1 elisa. Alternative names of the recognized antigen: TKR TKT2 TK 2 Transketolase-related protein Transketolase 2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Transketolase Like Protein 1 (TKTL1) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human TKT shRNA Plasmid
20-abx954853	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TKT Recombinant Protein (Human)
RP031648	ABM	100 ug	Ask for price

TKT Recombinant Protein (Human)
RP031651	ABM	100 ug	Ask for price

anti- Transketolase antibody
FNab08938	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: transketolase Uniprot ID: P29401 Gene ID: 7086 Research Area: Metabolism
Description: Antibody raised against Transketolase

anti- Transketolase antibody
FNab08939	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500-1:5000 IHC: 1:20-1:200 IF: 1:20-1:200 Immunogen: transketolase Uniprot ID: P29401 Gene ID: 7086 Research Area: Metabolism
Description: Antibody raised against Transketolase

Recombinant mouse Transketolase
P1406	FN Test	100ug	Ask for price
Uniprot ID: P40142 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for mouse Transketolase

Anti-Transketolase antibody
PAab08938	Lifescience Market	100 ug	EUR 386

ELISA kit for Human TKTL1 (Transketolase Like Protein 1)
ELK4675	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Transketolase Like Protein 1 (TKTL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific Show more
Description: A sandwich ELISA kit for detection of Transketolase Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

TKT Conjugated Antibody
C38817	SAB	100ul	EUR 397

TKT cloning plasmid
CSB-CL023580HU1-10ug	Cusabio	10ug	EUR 633
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1872 Sequence: atggagagctaccacaagcctgaccagcagaagctgcaggccttgaaggacacggccaaccgcctacgtatcagctccatccaggccaccactgcggcgggctctggccaccccacgtcatgctgcagcgccgcagagatcatggctgtcctctttttccacaccatgcgctaca Show more
Description: A cloning plasmid for the TKT gene.

TKT cloning plasmid
CSB-CL023580HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1374 Sequence: atggccttcgccagcatctataagctggacaaccttgtggccattctagacatcaatcgcctgggccagagtgacccggccccgctgcagcaccagatggacatctaccagaagcggtgcgaggccttcggttggcatgccatcatcgtggatggacacagcgtggaggagctgt Show more
Description: A cloning plasmid for the TKT gene.

TKT Polyclonal Antibody
ES11750-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

TKT Polyclonal Antibody
ES11750-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against TKT. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human TKT(Transketolase) ELISA Kit