Human STC1(Stanniocalcin 1) ELISA Kit

Human STC1(Stanniocalcin 1) ELISA Kit

Human Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
DLR-STC1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Stanniocalcin 1 (STC1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Stanniocalcin 1 (STC1) in samples from serum, plasma or other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Stanniocalcin 1 (STC1) ELISA Kit
RD-STC1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Stanniocalcin 1 (STC1) ELISA Kit
RDR-STC1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Stanniocalcin 1 (STC1) ELISA Kit
abx576396-96tests	Abbexa	96 tests	EUR 739
Shipped within 1-3 weeks.

Human STC1/ Stanniocalcin-1 ELISA Kit
E2412Hu	Sunlong	1 Kit	EUR 605

Human Stanniocalcin- 1, STC1 ELISA KIT
ELI-41328h	Lifescience Market	96 Tests	EUR 824

Human Stanniocalcin 1 (STC1) ELISA Kit
20-abx153168	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
SEC874Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Stanniocalcin 1 ELISA Kit (STC1)
RK02343	Abclonal	96 Tests	EUR 521

Human Stanniocalcin-1 (STC1)
1-CSB-RP098854h	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 50.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Human Stanniocalcin-1 (STC1)
1-CSB-RP098874HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 39.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Stanniocalcin-1(STC1),partial expressed in E.coli

Cow Stanniocalcin 1 (STC1) ELISA Kit
abx555794-96tests	Abbexa	96 tests	EUR 911
Shipped within 1-3 weeks.

Rat Stanniocalcin 1 (STC1) ELISA Kit
abx571149-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
abx576405-96tests	Abbexa	96 tests	EUR 668
Shipped within 1-3 weeks.

Bovine Stanniocalcin- 1, STC1 ELISA KIT
ELI-13825b	Lifescience Market	96 Tests	EUR 928

Mouse Stanniocalcin- 1, Stc1 ELISA KIT
ELI-39536m	Lifescience Market	96 Tests	EUR 865

Rat Stanniocalcin 1 (STC1) ELISA Kit
20-abx156121	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
20-abx154711	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Stanniocalcin-1(STC1) ELISA kit
CSB-EL022821MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1 (STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Stanniocalcin-1(STC1) ELISA kit
1-CSB-EL022821MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Stanniocalcin-1(STC1) in samples from serum, plasma, tissue homogenates, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
SEC874Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Stanniocalcin 1 (STC1) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Mouse Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Stanniocalcin 1 (STC1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
SEC874Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Stanniocalcin 1 (STC1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Stanniocalcin 1 (STC1) in serum, plasma and other biological fluids.

Rat Stanniocalcin 1 (STC1) ELISA Kit
4-SEC874Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Stanniocalcin 1 (STC1) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Stanniocalcin 1 ELISA Kit (STC1)
RK03214	Abclonal	96 Tests	EUR 521

Stanniocalcin 1 (STC1) Antibody
20-abx132353	Abbexa	EUR 328.00 EUR 829.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx101392	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx006838	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx028371-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx028371-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx174633	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx306443	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx320305	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
abx238315-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx241299	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody
20-abx178466	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx178467	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Stanniocalcin 1 (STC1) Antibody
20-abx178468	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Recombinant Stanniocalcin 1 (STC1)
4-RPC874Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P52823 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 56.8kDa Isoelectric Point: 7.3
Description: Recombinant Human Stanniocalcin 1 expressed in: E.coli

Recombinant Stanniocalcin 1 (STC1)
4-RPC874Mu01	Cloud-Clone	EUR 510.37 EUR 239.00 EUR 1638.88 EUR 612.96 EUR 1125.92 EUR 404.00 EUR 3947.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 54.7kDa Isoelectric Point: 8.9
Description: Recombinant Mouse Stanniocalcin 1 expressed in: E.coli

Human Stanniocalcin 1/STC1 PicoKine ELISA Kit
EK1404	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human STC1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ELISA kit for Human STC1 (Stanniocalcin 1)
ELK3332	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-1 (STC1)
KTE60383-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Stanniocalcin 1 (STC1) CLIA Kit
20-abx493944	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Stanniocalcin 1 (STC1) Protein
20-abx069167	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

ELISA kit for Mouse STC1 (Stanniocalcin 1)
ELK6277	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat STC1 (Stanniocalcin 1)
ELK6427	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 1 (STC1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Stanniocalcin-1 (STC1)
KTE100136-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Rat Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-48T	Abbkine	48T	EUR 332
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Stanniocalcin-1 (STC1)
KTE70268-96T	Abbkine	96T	EUR 539
Stanniocalcin-1 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The gene contains a 5' UTR rich in CAG trinucleotide repeats. The encoded protein contains 11 conser Show more
Description: Quantitative sandwich ELISA for measuring Mouse Stanniocalcin-1 (STC1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Stc1 ELISA Kit| Rat Stanniocalcin-1 ELISA Kit
EF019372	Lifescience Market	96 Tests	EUR 689

Stc1 ELISA Kit| Mouse Stanniocalcin-1 ELISA Kit
EF016295	Lifescience Market	96 Tests	EUR 689

STC1 ELISA Kit| Bovine Stanniocalcin-1 ELISA Kit
EF011935	Lifescience Market	96 Tests	EUR 689

Mouse Stanniocalcin 1 (STC1) CLIA Kit
20-abx493945	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Stanniocalcin 1 (STC1) CLIA Kit
20-abx493946	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Stanniocalcin 1 (STC1) Protein
20-abx655127	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Stanniocalcin 1 (STC1) Protein
20-abx655128	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Stanniocalcin 1 (STC1) Protein
20-abx655129	Abbexa	EUR 718.00 EUR 286.00 EUR 2207.00 EUR 843.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Stanniocalcin 1 Polyclonal (STC1) Antibody
20-abx116920	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (HRP)
20-abx306444	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)
20-abx306445	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)
20-abx306446	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Stanniocalcin 1 (STC1) Antibody (FITC)
20-abx271148	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Stanniocalcin 1 (STC1) Antibody (Biotin)
20-abx271414	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Anti-Stanniocalcin 1/STC1 Antibody
PA1997	BosterBio	100ug/vial	EUR 294

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human)
4-PAC874Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1)

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC
4-PAC874Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Biotinylated
4-PAC874Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), Cy3
4-PAC874Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), FITC
4-PAC874Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), HRP
4-PAC874Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), PE
4-PAC874Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig)
4-MAC874Hu22	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1)

Stanniocalcin 1 (STC1) Polyclonal Antibody (Human), APC-Cy7
4-PAC874Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: STC1 (Ser28-Ala247) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC
4-MAC874Hu22-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Biotinylated
4-MAC874Hu22-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Biotin.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), Cy3
4-MAC874Hu22-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with Cy3.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), FITC
4-MAC874Hu22-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with FITC.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), HRP
4-MAC874Hu22-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with HRP.

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), PE
4-MAC874Hu22-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with PE.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Stanniocalcin 1 (STC1) Monoclonal Antibody (Human, Pig), APC-Cy7
4-MAC874Hu22-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: Ser28-Ala247 Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Mouse monoclonal antibody against Human, Pig Stanniocalcin 1 (STC1). This antibody is labeled with APC-Cy7.

Human Stanniocalcin-2 (STC-2) AssayMax ELISA Kit
ES3731-1	AssayPro	96 Well Plate	EUR 417

Stc1/ Rat Stc1 ELISA Kit
ELI-29283r	Lifescience Market	96 Tests	EUR 886

STC1 ELISA KIT|Human
EF003296	Lifescience Market	96 Tests	EUR 689

ELISA kit for Human Stanniocalcin-1,STC-1
EK3747	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

STC1 ELISA Kit (Human) (OKCD00763)
OKCD00763	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 11.6 pg/mL

STC1 ELISA Kit (Human) (OKBB00964)
OKBB00964	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Stanniocalcin-1 is a glycoprotein which is encoded by the STC1 gene. This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. Human Stanniocalcin-1 is a putative molecular biomarker of leukemic microenvironment and the only molecular function known up to date is a SUMO E3 ligase activity in the SUMOylation cycle. STC1 interacts with lots of proteins in the cytoplasm, mitochondria, endoplasmatic reticulum and dot-like fashion in the nucleus. The N-terminal region of STC1 is the function region which is responsible to establish the interaction with its partners, including SUMO1. Low resolution studies shows that STC1 is an anti-parallel homodimer in solution and the cystein 202 is responsible for the dimerization of this protein. All the 5 dissulfide bonds of human STC1 are conserved and have the same profile of fish STC.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

STC-2 Stanniocalcin-2 Human Recombinant Protein
PROTO76061-1	BosterBio	Regular: 10ug	EUR 317
Description: Stanniocalcin-2 Human Recombinant produced in HEK 293 cell line is a single, glycosylated, polypeptide chain containing 289 amino acids and having a total molecular mass of 31.9kDa (calculated). The Stanniocalcin contains four extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-2 is 100% homologous to the amino acid sequence AA 25-302 of the human mature Human Stanniocalcin-2.

Recombinant Human Stanniocalcin-1
7-02332	CHI Scientific	2µg	Ask for price

Recombinant Human Stanniocalcin-1
7-02333	CHI Scientific	10µg	Ask for price

Recombinant Human Stanniocalcin-1
7-02334	CHI Scientific	100µg	Ask for price

Stanniocalcin-1 Protein
20-abx263197	Abbexa	EUR 1483.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Human Stanniocalcin-2 (STC2) ELISA Kit
abx575647-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Human Stanniocalcin-2
EK2997	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human STC2/ Stanniocalcin-2 ELISA Kit
E2413Hu	Sunlong	1 Kit	EUR 605

Human STC2(Stanniocalcin-2) ELISA Kit
EH1394	FN Test	96T	EUR 567.6
Detection range: 31.2-2000 pg/ml Uniprot ID: O76061 Alias: STC2/Stanniocalcin-2/STC-2/Stanniocalcin-related protein/STC-related protein/STCRP
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Stanniocalcin- 2, STC2 ELISA KIT
ELI-23671h	Lifescience Market	96 Tests	EUR 824

Human Stanniocalcin 2 (STC2) ELISA Kit
20-abx153169	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
abx250668-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-48T	DL Develop	48T	EUR 517
Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
DLR-STC2-Hu-96T	DL Develop	96T	EUR 673
Should the Human Stanniocalcin 2 (STC2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Stanniocalcin-2(STC2) ELISA kit
CSB-EL022822HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Stanniocalcin-2(STC2) ELISA kit
1-CSB-EL022822HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Stanniocalcin-2(STC2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Stanniocalcin 2 (STC2) ELISA Kit
RD-STC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stanniocalcin 2 (STC2) ELISA Kit
RDR-STC2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
SEF913Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Stanniocalcin 2 (STC2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Stanniocalcin 2 (STC2) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Stanniocalcin 2 (STC2) ELISA Kit
4-SEF913Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Stanniocalcin 2 elisa. Alternative names of the recognized antigen: STCRP Stanniocalcin-related protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Stanniocalcin 2 (STC2) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse Stanniocalcin-1,STC-1
EK3748	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-1,STC-1
EK3749	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-1,STC-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Stc1 ELISA Kit (Mouse) (OKCD01708)
OKCD01708	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 2.63 pg/mL

STC1 ELISA Kit (Rat) (OKDD00732)
OKDD00732	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: Calcium/phosphate-regulating protein; involved in stimulating osteoblast differentiation [rgd, feb 2006];Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.055 ng/mL

STC1 ELISA Kit (Mouse) (OKCA02193)
OKCA02193	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: Stimulates renal phosphate reabsorption, and could therefore prevent hypercalcemia.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL

Anti-Stanniocalcin 1 (1A3)
YF-MA15649	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Stanniocalcin 1

Anti-Stanniocalcin 1 (4H4)
YF-MA10890	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Stanniocalcin 1

ELISA kit for Human STC2 (Stanniocalcin 2)
E-EL-H2192	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's STC2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human STC2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human STC2 (Stanniocalcin 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human STC2 (Stanniocalcin 2)
ELK3575	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Stanniocalcin 2 (STC2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Stanniocalc Show more
Description: A sandwich ELISA kit for detection of Stanniocalcin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-48T	Abbkine	48T	EUR 332
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Stanniocalcin-2 (STC2)
KTE60384-96T	Abbkine	96T	EUR 539
Stanniocalcin-2 is a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members Show more
Description: Quantitative sandwich ELISA for measuring Human Stanniocalcin-2 (STC2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

STC-1 Stanniocalcin-1 Human Recombinant Protein
PROTP52823	BosterBio	Regular: 10ug	EUR 317
Description: Stanniocalcin-1 Human Recombinant produced in 293 cell line is a single, glycosylated, polypeptide chain containing 240 amino acids and having a total molecular mass of 25.9 kDa. The Stanniocalcin contains two extra residues which were used as a spacer and 8 residues form the C-Terminal Flag- tag.;Stanniocalcin is purified by proprietary chromatographic techniques.;The amino acid sequence of the recombinant human Stanniocalcin-1 is 100% homologous to the amino acid sequence AA 18-247 of the human mature Human Stanniocalcin-1.

Mouse Stanniocalcin-2 (STC2) ELISA Kit
abx515852-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Rat Stanniocalcin-2 (STC2) ELISA Kit
abx515853-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Mouse Stanniocalcin-2
EK2995	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Rat Stanniocalcin-2
EK2996	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Stanniocalcin-2 in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Stc2/ Stanniocalcin-2 ELISA Kit
E0948Ra	Sunlong	1 Kit	EUR 646

Mouse Stc2/ Stanniocalcin-2 ELISA Kit
E1422Mo	Sunlong	1 Kit	EUR 632

Mouse Stanniocalcin- 2, Stc2 ELISA KIT
ELI-52696m	Lifescience Market	96 Tests	EUR 865

Rat Stanniocalcin- 2, Stc2 ELISA KIT
ELI-29857r	Lifescience Market	96 Tests	EUR 886

Stanniocalcin protein
30R-3175	Fitzgerald	50 ug	EUR 257
Description: Purified recombinant Stanniocalcin protein

STC1 siRNA
20-abx905324	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC1 antibody
70R-6215	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal STC1 antibody raised against the N terminal of STC1

STC1 Antibody
ABD8393	Lifescience Market	100 ug	EUR 438

STC1 Antibody
40121-100ul	SAB	100ul	EUR 252

STC1 protein
30-1376	Fitzgerald	500 ug	EUR 392
Description: Recombinant STC1 protein

STC1 antibody
70R-20582	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STC1 antibody

STC1 Antibody
DF8393	Affbiotech	200ul	EUR 304
Description: STC1 Antibody detects endogenous levels of total STC1.

STC1 siRNA
20-abx935425	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC1 siRNA
20-abx935426	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STC1 Antibody
1-CSB-PA631492	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

STC1 Antibody
1-CSB-PA09889A0Rb	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody
1-CSB-PA022821ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

STC1 Antibody
1-CSB-PA022821GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STC1. Recognizes STC1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Stc2 ELISA Kit| Rat Stanniocalcin-2 ELISA Kit
EF019373	Lifescience Market	96 Tests	EUR 689

Stc2 ELISA Kit| Mouse Stanniocalcin-2 ELISA Kit
EF016296	Lifescience Market	96 Tests	EUR 689

Human Stanniocalcin 2 (STC2) CLIA Kit
20-abx495054	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Recombinant Human Stanniocalcin-2
7-02335	CHI Scientific	2µg	Ask for price

Recombinant Human Stanniocalcin-2
7-02336	CHI Scientific	10µg	Ask for price

Recombinant Human Stanniocalcin-2
7-02337	CHI Scientific	100µg	Ask for price

Human STC1 shRNA Plasmid
20-abx954638	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

STC1 Recombinant Protein (Human)
RP030376	ABM	100 ug	Ask for price

Recombinant (HEK 293) Stanniocalcin-1
RP-596	Alpha Diagnostics	10 ug	EUR 286

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

STC1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2301402	ABM	1.0 ug DNA	EUR 154

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Stanniocalcin-2 Protein
20-abx260786	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

Stanniocalcin-2 Protein
20-abx263198	Abbexa	EUR 1483.00 EUR 328.00 EUR 230.00	100 ug 10 ug 2 µg
Shipped within 5-10 working days.

Stanniocalcin 2 Antibody
DF12324	Affbiotech	200ul	EUR 304
Description: Stanniocalcin 2 antibody detects endogenous levels of Stanniocalcin 2.

anti-Stanniocalcin 2
YF-PA15746	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Stanniocalcin 2

STC1 Conjugated Antibody
C40121	SAB	100ul	EUR 397

STC1 cloning plasmid
CSB-CL022821HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 744 Sequence: atgctccaaaactcagcagtgcttctggtgctggtgatcagtgcttctgcaacccatgaggcggagcagaatgactctgtgagccccaggaaatcccgagtggcggctcaaaactcagctgaagtggttcgttgcctcaacagtgctctacaggtcggctgcggggcttttgcatg Show more
Description: A cloning plasmid for the STC1 gene.

STC1 Polyclonal Antibody
ES11126-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

STC1 Polyclonal Antibody
ES11126-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against STC1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

anti- STC1 antibody
FNab08315	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:100 Immunogen: stanniocalcin 1 Uniprot ID: P52823 Gene ID: 6781 Research Area: Signal Transduction, Metabolism
Description: Antibody raised against STC1

STC1 Polyclonal Antibody
ABP60537-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human STC1 protein Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody
ABP60537-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human STC1 protein Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody
ABP60537-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human STC1 protein Applications tips:
Description: A polyclonal antibody for detection of STC1 from Human, Mouse, Rat. This STC1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STC1 protein

STC1 Polyclonal Antibody
A61178	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

STC1 Rabbit pAb
A16976-100ul	Abclonal	100 ul	EUR 308

STC1 Rabbit pAb
A16976-200ul	Abclonal	200 ul	EUR 459

STC1 Rabbit pAb
A16976-20ul	Abclonal	20 ul	EUR 183

STC1 Rabbit pAb
A16976-50ul	Abclonal	50 ul	EUR 223

Human STC1(Stanniocalcin 1) ELISA Kit