Human SCGN(Secretagogin) ELISA Kit

Human SCGN(Secretagogin) ELISA Kit

Human Secretagogin (SCGN) ELISA Kit

RDR-SCGN-Hu-96Tests 96 Tests
EUR 756

Mouse Secretagogin (SCGN) ELISA Kit

EUR 527
  • Should the Mouse Secretagogin (SCGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretagogin (SCGN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Secretagogin (SCGN) ELISA Kit

EUR 688
  • Should the Mouse Secretagogin (SCGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Secretagogin (SCGN) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Secretagogin (SCGN) ELISA Kit

EUR 549
  • Should the Rat Secretagogin (SCGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Secretagogin (SCGN) in samples from serum, plasma or other biological fluids.

Rat Secretagogin (SCGN) ELISA Kit

EUR 718
  • Should the Rat Secretagogin (SCGN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Secretagogin (SCGN) in samples from serum, plasma or other biological fluids.

Mouse Secretagogin (SCGN) ELISA Kit

RD-SCGN-Mu-48Tests 48 Tests
EUR 533

Mouse Secretagogin (SCGN) ELISA Kit

RD-SCGN-Mu-96Tests 96 Tests
EUR 740

Rat Secretagogin (SCGN) ELISA Kit

RD-SCGN-Ra-48Tests 48 Tests
EUR 557

Rat Secretagogin (SCGN) ELISA Kit

RD-SCGN-Ra-96Tests 96 Tests
EUR 775

Mouse Secretagogin (SCGN) ELISA Kit

RDR-SCGN-Mu-48Tests 48 Tests
EUR 557

Mouse Secretagogin (SCGN) ELISA Kit

RDR-SCGN-Mu-96Tests 96 Tests
EUR 774

Rat Secretagogin (SCGN) ELISA Kit

RDR-SCGN-Ra-48Tests 48 Tests
EUR 583

Rat Secretagogin (SCGN) ELISA Kit

RDR-SCGN-Ra-96Tests 96 Tests
EUR 811

Human Secretagogin, SCGN ELISA KIT

ELI-53222h 96 Tests
EUR 824

Human Secretagogin (SCGN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Secretagogin (SCGN) ELISA Kit

SEG850Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretagogin (SCGN) ELISA Kit

SEG850Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretagogin (SCGN) ELISA Kit

SEG850Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretagogin (SCGN) ELISA Kit

SEG850Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Human Secretagogin (SCGN) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretagogin elisa. Alternative names of the recognized antigen: SECRET
  • SEGN
  • Calbindin-Like
  • Secretagogin, EF-Hand Calcium Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Secretagogin (SCGN) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Secretagogin (SCGN) ELISA Kit

CEG850Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Secretagogin (SCGN) in serum, plasma and other biological fluids.

Rat Secretagogin (SCGN) ELISA Kit

CEG850Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Secretagogin (SCGN) in serum, plasma and other biological fluids.

Rat Secretagogin (SCGN) ELISA Kit

CEG850Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Secretagogin (SCGN) in serum, plasma and other biological fluids.

Rat Secretagogin (SCGN) ELISA Kit

CEG850Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Rat Secretagogin (SCGN) in serum, plasma and other biological fluids.

Rat Secretagogin (SCGN) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretagogin elisa. Alternative names of the recognized antigen: SECRET
  • SEGN
  • Calbindin-Like
  • Secretagogin, EF-Hand Calcium Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Rat Secretagogin (SCGN) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Porcine Secretagogin, SCGN ELISA KIT

ELI-13432p 96 Tests
EUR 928

Mouse Secretagogin, Scgn ELISA KIT

ELI-53223m 96 Tests
EUR 865

Bovine Secretagogin, SCGN ELISA KIT

ELI-39295b 96 Tests
EUR 928

Rat Secretagogin (SCGN) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Secretagogin (SCGN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Secretagogin (SCGN) ELISA Kit

SEG850Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Secretagogin (SCGN) ELISA Kit

SEG850Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Secretagogin (SCGN) ELISA Kit

SEG850Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Secretagogin (SCGN) ELISA Kit

SEG850Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Secretagogin (SCGN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Secretagogin (SCGN) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Secretagogin (SCGN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Secretagogin elisa. Alternative names of the recognized antigen: SECRET
  • SEGN
  • Calbindin-Like
  • Secretagogin, EF-Hand Calcium Binding Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Secretagogin (SCGN) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Secretagogin (SCGN) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Secretagogin (SCGN) Antibody

  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Secretagogin (SCGN) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Secretagogin (SCGN) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretagogin (SCGN) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Secretagogin (SCGN) Protein

  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Secretagogin (SCGN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Secretagogin (SCGN)

  • EUR 476.32
  • EUR 230.00
  • EUR 1511.20
  • EUR 570.40
  • EUR 1040.80
  • EUR 382.00
  • EUR 3628.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O76038
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.9kDa
  • Isoelectric Point: 5.9
Description: Recombinant Human Secretagogin expressed in: E.coli

Recombinant Secretagogin (SCGN)

  • EUR 490.66
  • EUR 234.00
  • EUR 1564.96
  • EUR 588.32
  • EUR 1076.64
  • EUR 391.00
  • EUR 3762.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91WD9
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 35.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Secretagogin expressed in: E.coli

Recombinant Secretagogin (SCGN)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6R556
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Secretagogin expressed in: E.coli

ELISA kit for Human SCGN (Secretagogin)

ELK3652 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretagogin (SCGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretagogin (
  • Show more
Description: A sandwich ELISA kit for detection of Secretagogin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Secretagogin (SCGN)

KTE60738-48T 48T
EUR 332
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Secretagogin (SCGN)

KTE60738-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Secretagogin (SCGN)

KTE60738-96T 96T
EUR 539
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Secretagogin (SCGN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Secretagogin (SCGN) Protein

  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rat SCGN (Secretagogin)

ELK6364 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Secretagogin (SCGN) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Secretagogin (SCGN) and unlabeled Secretagogin (SCGN) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Secretagogin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse SCGN (Secretagogin)

ELK6365 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Secretagogin (SCGN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Secretagogin (
  • Show more
Description: A sandwich ELISA kit for detection of Secretagogin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Secretagogin (SCGN)

KTE100285-48T 48T
EUR 332
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Secretagogin (SCGN)

KTE100285-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Secretagogin (SCGN)

KTE100285-96T 96T
EUR 539
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Secretagogin (SCGN)

KTE70474-48T 48T
EUR 332
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Secretagogin (SCGN)

KTE70474-5platesof96wells 5 plates of 96 wells
EUR 2115
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Secretagogin (SCGN)

KTE70474-96T 96T
EUR 539
  • SCGN contains 6 tandem repeats of the EF-hand Ca(2+)-binding domain, with a loop at all 6 putative Ca(2+)-binding sites, and shares significant similarity with calbindin and calretinin. Much lower expression of only the smaller transcript was detecte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Secretagogin (SCGN) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Secretagogin (SCGN) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Secretagogin (SCGN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Secretagogin (SCGN) Protein

  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Secretagogin (SCGN) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

SCGN Secretagogin Human Recombinant Protein

PROTO76038 Regular: 10ug
EUR 317
Description: SCGN Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 296 amino acids (1-276 a.a.) and having a molecular mass of 34.2kDa. SCGN is fused to a 20 amino acid His tag at N-terminus and purified by standard chromatography techniques.

Secretagogin (SCGN) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN)

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN)

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse)

  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN)

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with APC.

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with Biotin.

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with Cy3.

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with FITC.

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with HRP.

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with PE.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), APC

  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with APC.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), Biotinylated

  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with Biotin.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), Cy3

  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with Cy3.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), FITC

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with FITC.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), HRP

  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with HRP.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), PE

  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with PE.

Secretagogin (SCGN) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with APC.

Secretagogin (SCGN) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with Biotin.

Secretagogin (SCGN) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with Cy3.

Secretagogin (SCGN) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with FITC.

Secretagogin (SCGN) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with HRP.

Secretagogin (SCGN) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with PE.

Secretagogin (SCGN) Polyclonal Antibody (Human, Pig), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Pig Secretagogin (SCGN). This antibody is labeled with APC-Cy7.

Secretagogin (SCGN) Polyclonal Antibody (Human, Mouse), APC-Cy7

  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Secretagogin (SCGN). This antibody is labeled with APC-Cy7.

Secretagogin (SCGN) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: SCGN (Met1~Pro276)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Secretagogin (SCGN). This antibody is labeled with APC-Cy7.

Monoclonal SCGN / Secretagogin Antibody (clone 2G7), Clone: 2G7

APR13210G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human SCGN / Secretagogin (clone 2G7). The antibodies are raised in Mouse and are from clone 2G7. This antibody is applicable in WB and IHC-P, E

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody

abx237633-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Protein

  • EUR 328.00
  • EUR 7358.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Scgn/ Rat Scgn ELISA Kit

ELI-29711r 96 Tests
EUR 886

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Secretagogin, EF-Hand Calcium Binding Protein (SCGN) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.


EF002742 96 Tests
EUR 689

SCGN ELISA Kit (Human) (OKCD00774)

OKCD00774 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 12.7 pg/mL


RA22122 100 ul
EUR 435

Recombinant Human Secretagogin

7-06331 2µg Ask for price

Recombinant Human Secretagogin

7-06332 10µg Ask for price

Recombinant Human Secretagogin

7-06333 1mg Ask for price

SCGN ELISA Kit (Mouse) (OKCD00205)

OKCD00205 96 Wells
EUR 857
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 6.4 pg/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCGN antibody

70R-2886 50 ug
EUR 467
Description: Rabbit polyclonal SCGN antibody raised against the middle region of SCGN

SCGN antibody

70R-2887 50 ug
EUR 467
Description: Rabbit polyclonal SCGN antibody raised against the middle region of SCGN

SCGN Antibody

ABD10192 100 ug
EUR 438

SCGN Antibody

44568-100ul 100ul
EUR 252

SCGN Antibody

44568-50ul 50ul
EUR 187

SCGN antibody

70R-20106 50 ul
EUR 435
Description: Rabbit polyclonal SCGN antibody


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SCGN Antibody

DF10192 200ul
EUR 304
Description: SCGN Antibody detects endogenous levels of total SCGN.

SCGN Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SCGN. Recognizes SCGN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SCGN Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCGN. Recognizes SCGN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200


PVT18361 2 ug
EUR 231


YF-PA17079 50 ul
EUR 363
Description: Mouse polyclonal to SCGN


YF-PA17080 50 ug
EUR 363
Description: Mouse polyclonal to SCGN


YF-PA17081 100 ug
EUR 403
Description: Rabbit polyclonal to SCGN


YF-PA25622 50 ul
EUR 334
Description: Mouse polyclonal to SCGN

Recombinant Rat Secretagogin

7-06334 2µg Ask for price

Recombinant Rat Secretagogin

7-06335 10µg Ask for price

Recombinant Rat Secretagogin

7-06336 1mg Ask for price

Anti-Secretagogin Antibody

M10629-1 100ul
EUR 397
Description: Rabbit Polyclonal Secretagogin Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Secretagogin Antibody

M10629-2 100ul
EUR 397
Description: Chicken Polyclonal Secretagogin Antibody. Validated in IF, IHC, WB and tested in Bovine, Human, Mouse, Rat.

Human SCGN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCGN Recombinant Protein (Human)

RP027739 100 ug Ask for price

SCGN Conjugated Antibody

C44568 100ul
EUR 397

SCGN cloning plasmid

CSB-CL020821HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 831
  • Sequence: atggacagctcccgggaaccgactctggggcgcttggacgccgctggcttctggcaggtctggcagcgctttgatgcggatgaaaaaggttacatagaagagaaggaactcgatgctttctttctccacatgttgatgaaactgggtactgatgacacggtcatgaaagcaaattt
  • Show more
Description: A cloning plasmid for the SCGN gene.

anti- SCGN antibody

FNab07633 100µg
EUR 548.75
  • Immunogen: secretagogin, EF-hand calcium binding protein
  • Uniprot ID: O76038
  • Gene ID: 10590
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against SCGN

SCGN Rabbit pAb

A12897-100ul 100 ul
EUR 308

SCGN Rabbit pAb

A12897-200ul 200 ul
EUR 459

SCGN Rabbit pAb

A12897-20ul 20 ul
EUR 183

SCGN Rabbit pAb

A12897-50ul 50 ul
EUR 223

SCGN Polyclonal Antibody

A63382 100 µg
EUR 570.55
Description: kits suitable for this type of research

SCGN Blocking Peptide

33R-4296 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCGN antibody, catalog no. 70R-2887

SCGN Blocking Peptide

33R-5304 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SCGN antibody, catalog no. 70R-2886

SCGN Blocking Peptide

DF10192-BP 1mg
EUR 195

Anti-SCGN antibody

PAab07633 100 ug
EUR 386

Anti-SCGN antibody

STJ114763 100 µl
EUR 277
Description: The encoded protein is a secreted calcium-binding protein which is found in the cytoplasm. It is related to calbindin D-28K and calretinin. This protein is thought to be involved in KCL-stimulated calcium flux and cell proliferation.

Anti-SCGN (2G7)

YF-MA11300 100 ug
EUR 363
Description: Mouse monoclonal to SCGN

SCGN ORF Vector (Human) (pORF)

ORF009247 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Secretagogin Polyclonal Chicken Antibody

CH22121 100 ug
EUR 435

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Mouse SCGN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SCGN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SCGN protein (His tag)

80R-1484 50 ug
EUR 305
Description: Purified recombinant Human SCGN protein

SCGN Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCGN. Recognizes SCGN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SCGN Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCGN. Recognizes SCGN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SCGN Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SCGN. Recognizes SCGN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-SCGN Monoclonal Antibody

M10629 100ug
EUR 397
Description: Rabbit Monoclonal SCGN Antibody. Validated in IP, WB and tested in Human, Mouse, Rat.

SCGN Recombinant Protein (Rat)

RP227639 100 ug Ask for price

SCGN Recombinant Protein (Mouse)

RP170225 100 ug Ask for price

SCGN sgRNA CRISPR Lentivector set (Human)

K2100901 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

EUR 153
  • Category: Cas9

Human SCGN(Secretagogin) ELISA Kit