Human NID2(Nidogen 2) ELISA Kit
Human NID2(Nidogen 2) ELISA Kit
Human Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Rat Nidogen 2 (NID2) ELISA Kit |
DLR-NID2-Ra-48T |
DL Develop |
48T |
EUR 549 |
- Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
DLR-NID2-Ra-96T |
DL Develop |
96T |
EUR 718 |
- Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
RD-NID2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Nidogen 2 (NID2) ELISA Kit |
RD-NID2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
Rat Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Nidogen 2 (NID2) ELISA Kit |
RDR-NID2-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human NID2/ Nidogen-2 ELISA Kit |
E1746Hu |
Sunlong |
1 Kit |
EUR 571 |
Human Nidogen 2 (NID2) ELISA Kit |
20-abx152525 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Nidogen 2 (NID2) ELISA Kit |
SEF416Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Human Nidogen 2 (NID2) ELISA Kit |
SEF416Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Human Nidogen 2 (NID2) ELISA Kit |
SEF416Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Human Nidogen 2 (NID2) ELISA Kit |
SEF416Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Human Nidogen 2 (NID2) ELISA Kit |
4-SEF416Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Nidogen 2 elisa. Alternative names of the recognized antigen: Osteonidogen
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nidogen 2 (NID2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rat Nidogen 2 (NID2) ELISA Kit |
20-abx155895 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Nidogen-2(NID2) ELISA kit |
CSB-EL015803MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Nidogen-2 (NID2) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Nidogen-2(NID2) ELISA kit |
1-CSB-EL015803MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Nidogen-2(NID2) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Rat Nidogen 2 (NID2) ELISA Kit |
SEF416Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
SEF416Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
SEF416Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
SEF416Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids. |
Rat Nidogen 2 (NID2) ELISA Kit |
4-SEF416Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Nidogen 2 elisa. Alternative names of the recognized antigen: Osteonidogen
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Nidogen 2 (NID2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Nidogen 2 (NID2) Antibody |
20-abx128335 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nidogen 2 (NID2) Antibody |
20-abx121180 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Nidogen 2 (NID2) Antibody |
abx022770-20ul |
Abbexa |
20 ul |
EUR 398 |
- Shipped within 5-10 working days.
|
Nidogen 2 (NID2) Antibody |
20-abx173827 |
Abbexa |
|
|
|
Nidogen 2 (NID2) Antibody |
20-abx173828 |
Abbexa |
|
|
|
Nidogen 2 (NID2) Antibody |
20-abx177809 |
Abbexa |
|
|
|
Nidogen 2 (NID2) Antibody |
abx235730-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Nidogen 2 (NID2) Antibody |
abx235731-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
Recombinant Nidogen 2 (NID2) |
4-RPF416Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q14112
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 32.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Nidogen 2 expressed in: E.coli |
Human Nidogen 2/Osteonidogen (NID2) ELISA Kit |
abx571104-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
ELISA kit for Human NID2 (Nidogen 2) |
E-EL-H5415 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's NID2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NID2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human NID2 (Nidogen 2) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human NID2 (Nidogen 2) |
ELK3649 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen 2 (NID2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen 2 (NID2).
- Show more
|
Description: A sandwich ELISA kit for detection of Nidogen 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Nidogen 2/Osteonidogen (NID2) ELISA Kit |
abx253834-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Nidogen 2 (NID2) CLIA Kit |
20-abx494897 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Nidogen 2 (NID2) Protein |
20-abx166530 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Nidogen 2/Osteonidogen (NID2) ELISA Kit |
abx512778-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Nidogen 2/Osteonidogen (NID2) ELISA Kit |
abx576112-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
ELISA kit for Rat NID2 (Nidogen 2) |
ELK6395 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen 2 (NID2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen 2 (NID2).
- Show more
|
Description: A sandwich ELISA kit for detection of Nidogen 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse Nidogen-2 (NID2) |
KTE71464-48T |
Abbkine |
48T |
EUR 332 |
- NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Nidogen-2 (NID2) |
KTE71464-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Nidogen-2 (NID2) |
KTE71464-96T |
Abbkine |
96T |
EUR 539 |
- NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Nidogen-2 (NID2) |
KTE100826-48T |
Abbkine |
48T |
EUR 332 |
- NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Nidogen-2 (NID2) |
KTE100826-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Nidogen-2 (NID2) |
KTE100826-96T |
Abbkine |
96T |
EUR 539 |
- NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Rat Nidogen 2 (NID2) CLIA Kit |
20-abx494898 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Nidogen 2 (NID2) Protein |
20-abx654562 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Nidogen 2/Osteonidogen (NID2) Antibody |
abx146312-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Nidogen 2 / Osteonidogen (NID2) Antibody |
20-abx217171 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nidogen 2 (NID2) Polyclonal Antibody (Human) |
4-PAF416Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2) |
Nidogen 2 (NID2) Polyclonal Antibody (Human), APC |
4-PAF416Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), Biotinylated |
4-PAF416Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Biotin. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), Cy3 |
4-PAF416Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Cy3. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), FITC |
4-PAF416Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with FITC. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), HRP |
4-PAF416Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with HRP. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), PE |
4-PAF416Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with PE. |
Nidogen 2 (NID2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAF416Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID2 (Leu31~Ala289)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC-Cy7. |
Human NID-2(Nidogen-2) ELISA Kit |
EH0878 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: Q14112
- Alias: NID-2/Nidogen-2/NID2/Osteonidogen/nidogen 2(osteonidogen)/Osteonidogen
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
NID2 ELISA Kit (Human) (OKCD08788) |
OKCD08788 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: Basement membranes, which are composed of type IV collagens, laminins, perlecan, and nidogen, are thin pericellular protein matrices that control a large number of cellular activities, including adhesion, migration, differentiation, gene expression, and apoptosis.Basement membranes, which are composed of type IV collagens (see MIM 120130), laminins (see LAMC1; MIM 150290), perlecan (HSPG2; MIM 142461), and nidogen (see NID1; MIM 131390), are thin pericellular protein matrices that control a large number of cellular activities, including adhesion, migration, differentiation, gene expression, and apoptosis...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL |
NID2 ELISA Kit (Human) (OKEH04310) |
OKEH04310 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL |
Human Nidogen (NID) ELISA Kit |
20-abx152524 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Nidogen (NID) ELISA Kit |
DLR-NID-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Nidogen (NID) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen (NID) in samples from serum, plasma or other biological fluids. |
Human Nidogen (NID) ELISA Kit |
DLR-NID-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Nidogen (NID) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen (NID) in samples from serum, plasma or other biological fluids. |
Human Nidogen (NID) ELISA Kit |
SEC466Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids. |
Human Nidogen (NID) ELISA Kit |
SEC466Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids. |
Human Nidogen (NID) ELISA Kit |
SEC466Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids. |
Human Nidogen (NID) ELISA Kit |
SEC466Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids. |
Human Nidogen (NID) ELISA Kit |
4-SEC466Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Nidogen elisa. Alternative names of the recognized antigen: Entactin
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nidogen (NID) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Nidogen (NID) ELISA Kit |
RD-NID-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Nidogen (NID) ELISA Kit |
RD-NID-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Nidogen (NID) ELISA Kit |
RDR-NID-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Nidogen (NID) ELISA Kit |
RDR-NID-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
anti-Nidogen 2 |
YF-PA17606 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to Nidogen 2 |
Human NID1/ Nidogen-1 ELISA Kit |
E1745Hu |
Sunlong |
1 Kit |
EUR 563 |
ELISA kit for Human NID (Nidogen) |
ELK3637 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen (NID). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen (NID). Next,
- Show more
|
Description: A sandwich ELISA kit for detection of Nidogen from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Nidogen 1 (NID1) ELISA Kit |
CSB-E13289h-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Nidogen 1 (NID1) in samples from serum, plasma, cell culture supernates
. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Nidogen 1 (NID1) ELISA Kit |
1-CSB-E13289h |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitative sandwich ELISA kit for measuring Human Nidogen 1 (NID1) in samples from serum, plasma, cell culture supernates
. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Human Nidogen (NID) |
KTE62218-48T |
Abbkine |
48T |
EUR 332 |
- Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin.
Entactin (or nidogen) is a member of the nidogen fam
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Nidogen (NID) |
KTE62218-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin.
Entactin (or nidogen) is a member of the nidogen fam
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Nidogen (NID) |
KTE62218-96T |
Abbkine |
96T |
EUR 539 |
- Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin.
Entactin (or nidogen) is a member of the nidogen fam
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
anti- Nidogen 2 antibody |
FNab05730 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: nidogen 2(osteonidogen)
- Uniprot ID: Q14112
- Research Area: Cardiovascular
|
Description: Antibody raised against Nidogen 2 |
anti- Nidogen 2 antibody |
FNab05731 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: nidogen 2(osteonidogen)
- Uniprot ID: Q14112
- Research Area: Cardiovascular
|
Description: Antibody raised against Nidogen 2 |
Nidogen 2 Blocking Peptide |
20-abx161180 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Anti-Nidogen 2 (4G8) |
YF-MA17728 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to Nidogen 2 |
NID2 ELISA Kit (Rat) (OKCD02713) |
OKCD02713 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: Cell adhesion glycoprotein. Might be involved in osteoblast differentiation. It probably has a role in cell-extracellular matrix interactions. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.2 ng/mL |
NID2 ELISA Kit (Mouse) (OKEH05840) |
OKEH05840 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Cell adhesion glycoprotein. Might be involved in osteoblast differentiation. It probably has a role in cell-extracellular matrix interactions. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.174 ng/mL |
Human Nidogen (NID) CLIA Kit |
20-abx493710 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Nidogen 1/Entactin (NID1) ELISA Kit |
abx251792-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
NID2 siRNA |
20-abx903561 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NID2 siRNA |
20-abx925899 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NID2 siRNA |
20-abx925900 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NID2 antibody |
70R-6064 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Rabbit polyclonal NID2 antibody |
NID2 Antibody |
46097-100ul |
SAB |
100ul |
EUR 252 |
NID2 Antibody |
46097-50ul |
SAB |
50ul |
EUR 187 |
NID2 antibody |
70R-18878 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal NID2 antibody |
NID2 Antibody |
DF9704 |
Affbiotech |
200ul |
EUR 304 |
Description: NID2 Antibody detects endogenous levels of total NID2. |
NID2 Antibody |
1-CSB-PA015803GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against NID2. Recognizes NID2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
Nidogen 2 (Osteonidogen) Polyclonal Antibody |
20-abx116872 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nidogen Antibody |
AF9131 |
Affbiotech |
200ul |
EUR 304 |
Description: Nidogen Antibody detects endogenous levels of total Nidogen. |
Nidogen Antibody |
44374-100ul |
SAB |
100ul |
EUR 252 |
Nidogen Antibody |
44374-50ul |
SAB |
50ul |
EUR 187 |
Rat Nid1/ Nidogen-1 ELISA Kit |
E0671Ra |
Sunlong |
1 Kit |
EUR 571 |
Mouse Nid1/ Nidogen-1 ELISA Kit |
E1026Mo |
Sunlong |
1 Kit |
EUR 571 |
NID2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1427103 |
ABM |
1.0 ug DNA |
EUR 154 |
AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-2 |
CORNING |
1/pk |
EUR 367 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Human NID2 shRNA Plasmid |
20-abx957775 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NID-1(Nidogen-1/Entactin) ELISA Kit |
EH0243 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P14543
- Alias: Nidogen-1/Entactin/NID-1/Entactin-1/NID1/NIDentactin/nidogen(enactin)/nidogen 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Nidogen-1/Entactin/NID-1 ELISA Kit |
LF-EK50935 |
Abfrontier |
1×96T |
EUR 648 |
Human Nidogen (NID) Protein |
20-abx166427 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Nidogen 1/Entactin (NID1) ELISA Kit |
abx514944-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Nidogen 1/Entactin (NID1) ELISA Kit |
abx514945-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
NID2 Conjugated Antibody |
C46097 |
SAB |
100ul |
EUR 397 |
NID2 cloning plasmid |
CSB-CL614513HU-10ug |
Cusabio |
10ug |
EUR 558 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2910
- Sequence: atggagggggaccgggtggccgggcggccggtgctgtcgtcgttaccagtgctactgctgctgcagttgctaatgttgcgggccgcggcgctgcacccagacgagctcttcccacacggggagtcgtggggggaccagctcctgcaggaaggcgacgacgaaagctcagccgtgg
- Show more
|
Description: A cloning plasmid for the NID2 gene. |
NID2 Polyclonal Antibody |
ES9927-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NID2 Polyclonal Antibody |
ES9927-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NID2 Polyclonal Antibody |
ABP59465-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
- Applications tips:
|
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 |
NID2 Polyclonal Antibody |
ABP59465-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
- Applications tips:
|
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 |
NID2 Polyclonal Antibody |
ABP59465-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
- Applications tips:
|
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 |
NID2 Blocking Peptide |
33R-1881 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064 |
NID2 Blocking Peptide |
DF9704-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-NID2 antibody |
STJ191085 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NID2 |
ELISA kit for Human Nidogen-1/Entactin/NID-1 |
EK5386 |
SAB |
96 tests |
EUR 553 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Nidogen-1/Entactin/NID-1 in samples from serum, plasma, tissue homogenates and other biological fluids. |
Human Nidogen-1/Entactin/NID-1 PicoKine ELISA Kit |
EK0856 |
BosterBio |
96 wells |
EUR 425 |
Description: For quantitative detection of human Nidogen-1 in cell culture supernates and serum. |
Nidogen-1/Entactin/NID-1 ELISA Kit (Human) (OKBB00454) |
OKBB00454 |
Aviva Systems Biology |
96 Wells |
EUR 505 |
Description: Description of target: Nidogen-1 (NID-1), also known as Entactin, is a protein that in humans is encoded by the NID1 gene. It is a member of the nidogen family of basement membrane glycoproteins. This gene is mapped to 1q42.3. Nidogen-1 is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans (heparan sulfate and glycosaminoglycans), laminin and fibronectin. The protein interacts with several other components of basement membranes. Structurally it (along with perlecan) connects the networks formed by collagens and laminins to each other. It may also play a role in cell interactions with the extracellular matrix. Nidogen-1 also can serve as a bridge between the 2 most abundant molecules in the basement membrane: type IV collagen and laminin.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL |
Nidogen Blocking Peptide |
AF9131-BP |
Affbiotech |
1mg |
EUR 195 |
Nidogen Conjugated Antibody |
C44374 |
SAB |
100ul |
EUR 397 |
Nidogen Polyclonal Antibody |
ES6392-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against Nidogen from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Nidogen Polyclonal Antibody |
ES6392-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against Nidogen from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
Nidogen (NID) Antibody |
20-abx128843 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Nidogen Polyclonal Antibody |
ABP55393-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270 |
Nidogen Polyclonal Antibody |
ABP55393-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270 |
Nidogen Polyclonal Antibody |
ABP55393-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270
- Applications tips:
|
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270 |
Nidogen (NID) Antibody |
20-abx173826 |
Abbexa |
|
|
|
Nidogen (NID1) Antibody |
20-abx217170 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Nidogen (NID) |
4-RPC466Hu01 |
Cloud-Clone |
-
EUR 413.60
-
EUR 214.00
-
EUR 1276.00
-
EUR 492.00
-
EUR 884.00
-
EUR 340.00
-
EUR 3040.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P14543
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 31.6kDa
- Isoelectric Point: 6.3
|
Description: Recombinant Human Nidogen expressed in: E.coli |
Anti-Nidogen antibody |
STJ94491 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Rabbit polyclonal to Nidogen. |
NID2 ORF Vector (Human) (pORF) |
ORF007075 |
ABM |
1.0 ug DNA |
EUR 95 |
Nid2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
K3848803 |
ABM |
1.0 ug DNA |
EUR 154 |
Nid2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K6291203 |
ABM |
1.0 ug DNA |
EUR 154 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Rat NID2 shRNA Plasmid |
20-abx989144 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse NID2 shRNA Plasmid |
20-abx971748 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
NID2 sgRNA CRISPR Lentivector set (Human) |
K1427101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Nidogen 1 (NID1) Antibody |
20-abx110047 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen 1 (NID1) Antibody |
20-abx110048 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen-1 Antibody (HRP) |
20-abx108559 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen-1 Antibody (HRP) |
20-abx108560 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen 1 (NID1) Antibody |
20-abx133584 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Nidogen 1 Blocking Peptide |
20-abx061166 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Nidogen-1 Antibody (Biotin) |
20-abx105720 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen-1 Antibody (Biotin) |
20-abx105721 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen-1 Antibody (FITC) |
20-abx107137 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Nidogen-1 Antibody (FITC) |
20-abx107138 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Mouse Nidogen-1 (Nid1) |
1-CSB-YP015802MO |
Cusabio |
-
EUR 586.00
-
EUR 299.00
-
EUR 2172.00
-
EUR 900.00
-
EUR 1442.00
-
EUR 382.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 28.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Nidogen-1(Nid1) ,partial expressed in Yeast |
Mouse Nidogen-1 (Nid1) |
1-CSB-YP015802MOe1 |
Cusabio |
-
EUR 703.00
-
EUR 415.00
-
EUR 2288.00
-
EUR 1016.00
-
EUR 1558.00
-
EUR 498.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 26.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Nidogen-1(Nid1),partial expressed in Yeast |
Mouse Nidogen-1 (Nid1) |
1-CSB-EP015802MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 30.3 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Nidogen-1(Nid1),partial expressed in E.coli |
Nidogen (NID) Polyclonal Antibody (Human, Mouse) |
4-PAC466Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NID (Ala971~Cys1219)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Human, Mouse Nidogen (NID) |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
Human NID2(Nidogen 2) ELISA Kit