Human NID2(Nidogen 2) ELISA Kit

Human Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Rat Nidogen 2 (NID2) ELISA Kit
DLR-NID2-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit
DLR-NID2-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit
RD-NID2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Nidogen 2 (NID2) ELISA Kit
RD-NID2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Rat Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Nidogen 2 (NID2) ELISA Kit
RDR-NID2-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human NID2/ Nidogen-2 ELISA Kit
E1746Hu	Sunlong	1 Kit	EUR 571

Human Nidogen 2 (NID2) ELISA Kit
20-abx152525	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nidogen 2(NID2)ELISA Kit
QY-E04029	Qayee Biotechnology	96T	EUR 361

Human Nidogen 2 (NID2) ELISA Kit
SEF416Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit
SEF416Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit
SEF416Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit
SEF416Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit
4-SEF416Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nidogen 2 elisa. Alternative names of the recognized antigen: Osteonidogen
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nidogen 2 (NID2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Nidogen 2 (NID2) ELISA Kit
20-abx155895	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Nidogen-2(NID2) ELISA kit
CSB-EL015803MO-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Nidogen-2 (NID2) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Nidogen-2(NID2) ELISA kit
1-CSB-EL015803MO	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Nidogen-2(NID2) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Nidogen 2(NID2)ELISA Kit
QY-E10210	Qayee Biotechnology	96T	EUR 361

Mouse Nidogen 2(NID2)ELISA Kit
QY-E21089	Qayee Biotechnology	96T	EUR 361

Rat Nidogen 2 (NID2) ELISA Kit
SEF416Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit
SEF416Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit
SEF416Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit
SEF416Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit
4-SEF416Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nidogen 2 elisa. Alternative names of the recognized antigen: Osteonidogen
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Nidogen 2 (NID2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Nidogen 2 (NID2) Antibody
20-abx128335	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nidogen 2 (NID2) Antibody
20-abx121180	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody
abx022770-20ul	Abbexa	20 ul	EUR 398
Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody
20-abx173827	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Nidogen 2 (NID2) Antibody
20-abx173828	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Nidogen 2 (NID2) Antibody
20-abx177809	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Nidogen 2 (NID2) Antibody
abx235730-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Nidogen 2 (NID2) Antibody
abx235731-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Nidogen 2 (NID2)
4-RPF416Hu01	Cloud-Clone	EUR 458.40 EUR 226.00 EUR 1444.00 EUR 548.00 EUR 996.00 EUR 370.00 EUR 3460.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q14112 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 32.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Nidogen 2 expressed in: E.coli

Human Nidogen 2/Osteonidogen (NID2) ELISA Kit
abx571104-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

ELISA kit for Human NID2 (Nidogen 2)
E-EL-H5415	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's NID2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NID2. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NID2 (Nidogen 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NID2 (Nidogen 2)
ELK3649	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen 2 (NID2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen 2 (NID2). Show more
Description: A sandwich ELISA kit for detection of Nidogen 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Nidogen 2/Osteonidogen (NID2) ELISA Kit
abx253834-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Nidogen 2 (NID2) CLIA Kit
20-abx494897	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Nidogen 2 (NID2) Protein
20-abx166530	Abbexa	EUR 648.00 EUR 272.00 EUR 1943.00 EUR 759.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Nidogen 2/Osteonidogen (NID2) ELISA Kit
abx512778-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Nidogen 2/Osteonidogen (NID2) ELISA Kit
abx576112-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

ELISA kit for Rat NID2 (Nidogen 2)
ELK6395	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen 2 (NID2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen 2 (NID2). Show more
Description: A sandwich ELISA kit for detection of Nidogen 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Nidogen-2 (NID2)
KTE71464-48T	Abbkine	48T	EUR 332
NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nidogen-2 (NID2)
KTE71464-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nidogen-2 (NID2)
KTE71464-96T	Abbkine	96T	EUR 539
NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nidogen-2 (NID2)
KTE100826-48T	Abbkine	48T	EUR 332
NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq Show more
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nidogen-2 (NID2)
KTE100826-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq Show more
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nidogen-2 (NID2)
KTE100826-96T	Abbkine	96T	EUR 539
NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq Show more
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Nidogen 2 (NID2) CLIA Kit
20-abx494898	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Nidogen 2 (NID2) Protein
20-abx654562	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Nidogen 2/Osteonidogen (NID2) Antibody
abx146312-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Nidogen 2 / Osteonidogen (NID2) Antibody
20-abx217171	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Nidogen 2 (NID2) Polyclonal Antibody (Human)
4-PAF416Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2)

Nidogen 2 (NID2) Polyclonal Antibody (Human), APC
4-PAF416Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC.

Nidogen 2 (NID2) Polyclonal Antibody (Human), Biotinylated
4-PAF416Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Biotin.

Nidogen 2 (NID2) Polyclonal Antibody (Human), Cy3
4-PAF416Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Cy3.

Nidogen 2 (NID2) Polyclonal Antibody (Human), FITC
4-PAF416Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with FITC.

Nidogen 2 (NID2) Polyclonal Antibody (Human), HRP
4-PAF416Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with HRP.

Nidogen 2 (NID2) Polyclonal Antibody (Human), PE
4-PAF416Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with PE.

Nidogen 2 (NID2) Polyclonal Antibody (Human), APC-Cy7
4-PAF416Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID2 (Leu31~Ala289) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC-Cy7.

Human NID-2(Nidogen-2) ELISA Kit
EH0878	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q14112 Alias: NID-2/Nidogen-2/NID2/Osteonidogen/nidogen 2(osteonidogen)/Osteonidogen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human NID2 ELISA Kit
ELA-E0383h	Lifescience Market	96 Tests	EUR 824

NID2 ELISA Kit (Human) (OKCD08788)
OKCD08788	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Basement membranes, which are composed of type IV collagens, laminins, perlecan, and nidogen, are thin pericellular protein matrices that control a large number of cellular activities, including adhesion, migration, differentiation, gene expression, and apoptosis.Basement membranes, which are composed of type IV collagens (see MIM 120130), laminins (see LAMC1; MIM 150290), perlecan (HSPG2; MIM 142461), and nidogen (see NID1; MIM 131390), are thin pericellular protein matrices that control a large number of cellular activities, including adhesion, migration, differentiation, gene expression, and apoptosis...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

NID2 ELISA Kit (Human) (OKEH04310)
OKEH04310	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL

Human Nidogen (NID) ELISA Kit
20-abx152524	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Nidogen (NID) ELISA Kit
DLR-NID-Hu-48T	DL Develop	48T	EUR 517
Should the Human Nidogen (NID) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen (NID) in samples from serum, plasma or other biological fluids.

Human Nidogen (NID) ELISA Kit
DLR-NID-Hu-96T	DL Develop	96T	EUR 673
Should the Human Nidogen (NID) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen (NID) in samples from serum, plasma or other biological fluids.

Human Nidogen (NID) ELISA Kit
SEC466Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit
SEC466Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit
SEC466Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit
SEC466Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit
4-SEC466Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Nidogen elisa. Alternative names of the recognized antigen: Entactin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nidogen (NID) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Nidogen (NID) ELISA Kit
RD-NID-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Nidogen (NID) ELISA Kit
RD-NID-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Nidogen (NID) ELISA Kit
RDR-NID-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Nidogen (NID) ELISA Kit
RDR-NID-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Nidogen(NID)ELISA Kit
QY-E04030	Qayee Biotechnology	96T	EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

anti-Nidogen 2
YF-PA17606	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Nidogen 2

Human NID1/ Nidogen-1 ELISA Kit
E1745Hu	Sunlong	1 Kit	EUR 563

Human Nidogen- 1, NID1 ELISA KIT
ELI-03424h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human NID (Nidogen)
ELK3637	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen (NID). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen (NID). Next, Show more
Description: A sandwich ELISA kit for detection of Nidogen from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Nidogen 1 (NID1) ELISA Kit
CSB-E13289h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Nidogen 1 (NID1) in samples from serum, plasma, cell culture supernates . A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Nidogen 1 (NID1) ELISA Kit
1-CSB-E13289h	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Nidogen 1 (NID1) in samples from serum, plasma, cell culture supernates . Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Nidogen (NID)
KTE62218-48T	Abbkine	48T	EUR 332
Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin. Entactin (or nidogen) is a member of the nidogen fam Show more
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nidogen (NID)
KTE62218-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin. Entactin (or nidogen) is a member of the nidogen fam Show more
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nidogen (NID)
KTE62218-96T	Abbkine	96T	EUR 539
Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin. Entactin (or nidogen) is a member of the nidogen fam Show more
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

anti- Nidogen 2 antibody
FNab05730	FN Test	100µg	EUR 505.25
Immunogen: nidogen 2(osteonidogen) Uniprot ID: Q14112 Research Area: Cardiovascular
Description: Antibody raised against Nidogen 2

anti- Nidogen 2 antibody
FNab05731	FN Test	100µg	EUR 505.25
Immunogen: nidogen 2(osteonidogen) Uniprot ID: Q14112 Research Area: Cardiovascular
Description: Antibody raised against Nidogen 2

Nidogen 2 Blocking Peptide
20-abx161180	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

Anti-Nidogen 2 antibody
PAab05730	Lifescience Market	100 ug	EUR 355

Anti-Nidogen 2 antibody
PAab05731	Lifescience Market	100 ug	EUR 355

Anti-Nidogen 2 (4G8)
YF-MA17728	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to Nidogen 2

NID2 ELISA Kit (Rat) (OKCD02713)
OKCD02713	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: Cell adhesion glycoprotein. Might be involved in osteoblast differentiation. It probably has a role in cell-extracellular matrix interactions. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.2 ng/mL

NID2 ELISA Kit (Mouse) (OKEH05840)
OKEH05840	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Cell adhesion glycoprotein. Might be involved in osteoblast differentiation. It probably has a role in cell-extracellular matrix interactions. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.174 ng/mL

Human Nidogen (NID) CLIA Kit
20-abx493710	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Nidogen 1/Entactin (NID1) ELISA Kit
abx251792-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

NID2 siRNA
20-abx903561	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NID2 Antibody
ABD9704	Lifescience Market	100 ug	EUR 438

NID2 siRNA
20-abx925899	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NID2 siRNA
20-abx925900	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

NID2 antibody
70R-6064	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal NID2 antibody

NID2 Antibody
46097-100ul	SAB	100ul	EUR 252

NID2 Antibody
46097-50ul	SAB	50ul	EUR 187

NID2 antibody
70R-18878	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal NID2 antibody

NID2 Antibody
DF9704	Affbiotech	200ul	EUR 304
Description: NID2 Antibody detects endogenous levels of total NID2.

NID2 Antibody
1-CSB-PA015803GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NID2. Recognizes NID2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Nidogen 2 (Osteonidogen) Polyclonal Antibody
20-abx116872	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Nidogen Antibody
AF9131	Affbiotech	200ul	EUR 304
Description: Nidogen Antibody detects endogenous levels of total Nidogen.

Nidogen Antibody
ABF9131	Lifescience Market	100 ug	EUR 438

Nidogen Antibody
44374-100ul	SAB	100ul	EUR 252

Nidogen Antibody
44374-50ul	SAB	50ul	EUR 187

Rat Nid1/ Nidogen-1 ELISA Kit
E0671Ra	Sunlong	1 Kit	EUR 571

Mouse Nid1/ Nidogen-1 ELISA Kit
E1026Mo	Sunlong	1 Kit	EUR 571

Mouse Nidogen- 1, Nid1 ELISA KIT
ELI-03422m	Lifescience Market	96 Tests	EUR 865

NID2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1427103	ABM	1.0 ug DNA	EUR 154

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human NID2 shRNA Plasmid
20-abx957775	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human NID-1(Nidogen-1/Entactin) ELISA Kit
EH0243	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: P14543 Alias: Nidogen-1/Entactin/NID-1/Entactin-1/NID1/NIDentactin/nidogen(enactin)/nidogen 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Nidogen-1/Entactin/NID-1 ELISA Kit
LF-EK50935	Abfrontier	1×96T	EUR 648

Human Nidogen (NID) Protein
20-abx166427	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Nidogen 1/Entactin (NID1) ELISA Kit
abx514944-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Nidogen 1/Entactin (NID1) ELISA Kit
abx514945-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

NID2 Conjugated Antibody
C46097	SAB	100ul	EUR 397

NID2 cloning plasmid
CSB-CL614513HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2910 Sequence: atggagggggaccgggtggccgggcggccggtgctgtcgtcgttaccagtgctactgctgctgcagttgctaatgttgcgggccgcggcgctgcacccagacgagctcttcccacacggggagtcgtggggggaccagctcctgcaggaaggcgacgacgaaagctcagccgtgg Show more
Description: A cloning plasmid for the NID2 gene.

NID2 Polyclonal Antibody
ES9927-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NID2 Polyclonal Antibody
ES9927-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NID2 Polyclonal Antibody
ABP59465-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

NID2 Polyclonal Antibody
ABP59465-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

NID2 Polyclonal Antibody
ABP59465-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780 Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

NID2 Blocking Peptide
33R-1881	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064

NID2 Blocking Peptide
DF9704-BP	Affbiotech	1mg	EUR 195

Anti-NID2 antibody
STJ191085	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to NID2

ELISA kit for Human Nidogen-1/Entactin/NID-1
EK5386	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Nidogen-1/Entactin/NID-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Nidogen-1/Entactin/NID-1 PicoKine ELISA Kit
EK0856	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human Nidogen-1 in cell culture supernates and serum.

Nidogen-1/Entactin/NID-1 ELISA Kit (Human) (OKBB00454)
OKBB00454	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Nidogen-1 (NID-1), also known as Entactin, is a protein that in humans is encoded by the NID1 gene. It is a member of the nidogen family of basement membrane glycoproteins. This gene is mapped to 1q42.3. Nidogen-1 is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans (heparan sulfate and glycosaminoglycans), laminin and fibronectin. The protein interacts with several other components of basement membranes. Structurally it (along with perlecan) connects the networks formed by collagens and laminins to each other. It may also play a role in cell interactions with the extracellular matrix. Nidogen-1 also can serve as a bridge between the 2 most abundant molecules in the basement membrane: type IV collagen and laminin.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Nidogen Blocking Peptide
AF9131-BP	Affbiotech	1mg	EUR 195

Nidogen Conjugated Antibody
C44374	SAB	100ul	EUR 397

Nidogen Polyclonal Antibody
ES6392-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nidogen from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nidogen Polyclonal Antibody
ES6392-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nidogen from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nidogen (NID) Antibody
20-abx128843	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Nidogen Polyclonal Antibody
ABP55393-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270 Applications tips:
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270

Nidogen Polyclonal Antibody
ABP55393-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270 Applications tips:
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270

Nidogen Polyclonal Antibody
ABP55393-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270 Applications tips:
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270

Nidogen (NID) Antibody
20-abx173826	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Nidogen (NID1) Antibody
20-abx217170	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Recombinant Nidogen (NID)
4-RPC466Hu01	Cloud-Clone	EUR 413.60 EUR 214.00 EUR 1276.00 EUR 492.00 EUR 884.00 EUR 340.00 EUR 3040.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P14543 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.6kDa Isoelectric Point: 6.3
Description: Recombinant Human Nidogen expressed in: E.coli

Anti-Nidogen antibody
STJ94491	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to Nidogen.

NID2 ORF Vector (Human) (pORF)
ORF007075	ABM	1.0 ug DNA	EUR 95

Nid2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3848803	ABM	1.0 ug DNA	EUR 154

Nid2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6291203	ABM	1.0 ug DNA	EUR 154

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat NID2 shRNA Plasmid
20-abx989144	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse NID2 shRNA Plasmid
20-abx971748	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

NID2 sgRNA CRISPR Lentivector set (Human)
K1427101	ABM	3 x 1.0 ug	EUR 339

Nidogen 1 (NID1) Antibody
20-abx110047	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen 1 (NID1) Antibody
20-abx110048	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen-1 Antibody (HRP)
20-abx108559	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen-1 Antibody (HRP)
20-abx108560	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen 1 (NID1) Antibody
20-abx133584	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Nidogen 1 Blocking Peptide
20-abx061166	Abbexa	EUR 286.00 EUR 425.00	1 mg 5 mg
Shipped within 5-10 working days.

Nidogen-1 Antibody (Biotin)
20-abx105720	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen-1 Antibody (Biotin)
20-abx105721	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen-1 Antibody (FITC)
20-abx107137	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Nidogen-1 Antibody (FITC)
20-abx107138	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Mouse Nidogen-1 (Nid1)
1-CSB-YP015802MO	Cusabio	EUR 586.00 EUR 299.00 EUR 2172.00 EUR 900.00 EUR 1442.00 EUR 382.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 28.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Nidogen-1(Nid1) ,partial expressed in Yeast

Mouse Nidogen-1 (Nid1)
1-CSB-YP015802MOe1	Cusabio	EUR 703.00 EUR 415.00 EUR 2288.00 EUR 1016.00 EUR 1558.00 EUR 498.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 26.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Nidogen-1(Nid1),partial expressed in Yeast

Mouse Nidogen-1 (Nid1)
1-CSB-EP015802MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 30.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Nidogen-1(Nid1),partial expressed in E.coli

Nidogen (NID) Polyclonal Antibody (Human, Mouse)
4-PAC466Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: NID (Ala971~Cys1219) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Nidogen (NID)

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Human NID2(Nidogen 2) ELISA Kit