Human NID2(Nidogen 2) ELISA Kit

Human NID2(Nidogen 2) ELISA Kit

Human Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Hu-96Tests 96 Tests
EUR 756

Rat Nidogen 2 (NID2) ELISA Kit

DLR-NID2-Ra-48T 48T
EUR 549
  • Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

DLR-NID2-Ra-96T 96T
EUR 718
  • Should the Rat Nidogen 2 (NID2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Nidogen 2 (NID2) in samples from serum, plasma or other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

RD-NID2-Ra-48Tests 48 Tests
EUR 557

Rat Nidogen 2 (NID2) ELISA Kit

RD-NID2-Ra-96Tests 96 Tests
EUR 775

Rat Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Ra-48Tests 48 Tests
EUR 583

Rat Nidogen 2 (NID2) ELISA Kit

RDR-NID2-Ra-96Tests 96 Tests
EUR 811

Human NID2/ Nidogen-2 ELISA Kit

E1746Hu 1 Kit
EUR 571

Human Nidogen 2 (NID2) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nidogen 2(NID2)ELISA Kit

QY-E04029 96T
EUR 361

Human Nidogen 2 (NID2) ELISA Kit

SEF416Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit

SEF416Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit

SEF416Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit

SEF416Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Human Nidogen 2 (NID2) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nidogen 2 elisa. Alternative names of the recognized antigen: Osteonidogen
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nidogen 2 (NID2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Nidogen 2 (NID2) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Nidogen-2(NID2) ELISA kit

CSB-EL015803MO-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Nidogen-2 (NID2) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Mouse Nidogen-2(NID2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Mouse Nidogen-2(NID2) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Rat Nidogen 2(NID2)ELISA Kit

QY-E10210 96T
EUR 361

Mouse Nidogen 2(NID2)ELISA Kit

QY-E21089 96T
EUR 361

Rat Nidogen 2 (NID2) ELISA Kit

SEF416Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

SEF416Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

SEF416Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

SEF416Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Nidogen 2 (NID2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Nidogen 2 (NID2) in serum, plasma and other biological fluids.

Rat Nidogen 2 (NID2) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nidogen 2 elisa. Alternative names of the recognized antigen: Osteonidogen
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Nidogen 2 (NID2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Nidogen 2 (NID2) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nidogen 2 (NID2) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody

abx022770-20ul 20 ul
EUR 398
  • Shipped within 5-10 working days.

Nidogen 2 (NID2) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen 2 (NID2) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen 2 (NID2) Antibody

  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen 2 (NID2) Antibody

abx235730-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Nidogen 2 (NID2) Antibody

abx235731-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Nidogen 2 (NID2)

  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q14112
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Nidogen 2 expressed in: E.coli

Human Nidogen 2/Osteonidogen (NID2) ELISA Kit

abx571104-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

ELISA kit for Human NID2 (Nidogen 2)

E-EL-H5415 1 plate of 96 wells
EUR 534
  • Gentaur's NID2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human NID2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human NID2 (Nidogen 2) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human NID2 (Nidogen 2)

ELK3649 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen 2 (NID2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen 2 (NID2).
  • Show more
Description: A sandwich ELISA kit for detection of Nidogen 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Nidogen 2/Osteonidogen (NID2) ELISA Kit

abx253834-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Nidogen 2 (NID2) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Nidogen 2 (NID2) Protein

  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Nidogen 2/Osteonidogen (NID2) ELISA Kit

abx512778-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Nidogen 2/Osteonidogen (NID2) ELISA Kit

abx576112-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

ELISA kit for Rat NID2 (Nidogen 2)

ELK6395 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen 2 (NID2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen 2 (NID2).
  • Show more
Description: A sandwich ELISA kit for detection of Nidogen 2 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Nidogen-2 (NID2)

KTE71464-48T 48T
EUR 332
  • NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nidogen-2 (NID2)

KTE71464-5platesof96wells 5 plates of 96 wells
EUR 2115
  • NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Nidogen-2 (NID2)

KTE71464-96T 96T
EUR 539
  • NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nidogen-2 (NID2)

KTE100826-48T 48T
EUR 332
  • NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nidogen-2 (NID2)

KTE100826-5platesof96wells 5 plates of 96 wells
EUR 2115
  • NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Nidogen-2 (NID2)

KTE100826-96T 96T
EUR 539
  • NID2 protein, 46% identical to NID1, contains a 30-residue signal peptide, 49 primarily central cys residues, 5 potential N-linked glycosylation sites, 2 tyr residues in a potential O-sulfation sequence, and a YGD rather than an RGD cell adhesion seq
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Nidogen-2 (NID2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rat Nidogen 2 (NID2) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Nidogen 2 (NID2) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Nidogen 2/Osteonidogen (NID2) Antibody

abx146312-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Nidogen 2 / Osteonidogen (NID2) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen 2 (NID2) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2)

Nidogen 2 (NID2) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC.

Nidogen 2 (NID2) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Biotin.

Nidogen 2 (NID2) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with Cy3.

Nidogen 2 (NID2) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with FITC.

Nidogen 2 (NID2) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with HRP.

Nidogen 2 (NID2) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with PE.

Nidogen 2 (NID2) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID2 (Leu31~Ala289)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Nidogen 2 (NID2). This antibody is labeled with APC-Cy7.

Human NID-2(Nidogen-2) ELISA Kit

EH0878 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: Q14112
  • Alias: NID-2/Nidogen-2/NID2/Osteonidogen/nidogen 2(osteonidogen)/Osteonidogen
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human NID2 ELISA Kit

ELA-E0383h 96 Tests
EUR 824

NID2 ELISA Kit (Human) (OKCD08788)

OKCD08788 96 Wells
EUR 975
Description: Description of target: Basement membranes, which are composed of type IV collagens, laminins, perlecan, and nidogen, are thin pericellular protein matrices that control a large number of cellular activities, including adhesion, migration, differentiation, gene expression, and apoptosis.Basement membranes, which are composed of type IV collagens (see MIM 120130), laminins (see LAMC1; MIM 150290), perlecan (HSPG2; MIM 142461), and nidogen (see NID1; MIM 131390), are thin pericellular protein matrices that control a large number of cellular activities, including adhesion, migration, differentiation, gene expression, and apoptosis...;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

NID2 ELISA Kit (Human) (OKEH04310)

OKEH04310 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the nidogen family of basement membrane proteins. This protein is a cell-adhesion protein that binds collagens I and IV and laminin and may be involved in maintaining the structure of the basement membrane.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32 ng/mL

Human Nidogen (NID) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Nidogen (NID) ELISA Kit

DLR-NID-Hu-48T 48T
EUR 517
  • Should the Human Nidogen (NID) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen (NID) in samples from serum, plasma or other biological fluids.

Human Nidogen (NID) ELISA Kit

DLR-NID-Hu-96T 96T
EUR 673
  • Should the Human Nidogen (NID) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Nidogen (NID) in samples from serum, plasma or other biological fluids.

Human Nidogen (NID) ELISA Kit

SEC466Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit

SEC466Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit

SEC466Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit

SEC466Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Nidogen (NID) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Nidogen (NID) in serum, plasma and other biological fluids.

Human Nidogen (NID) ELISA Kit

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Nidogen elisa. Alternative names of the recognized antigen: Entactin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Nidogen (NID) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Nidogen (NID) ELISA Kit

RD-NID-Hu-48Tests 48 Tests
EUR 521

Human Nidogen (NID) ELISA Kit

RD-NID-Hu-96Tests 96 Tests
EUR 723

Human Nidogen (NID) ELISA Kit

RDR-NID-Hu-48Tests 48 Tests
EUR 544

Human Nidogen (NID) ELISA Kit

RDR-NID-Hu-96Tests 96 Tests
EUR 756

Human Nidogen(NID)ELISA Kit

QY-E04030 96T
EUR 361

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

anti-Nidogen 2

YF-PA17606 50 ug
EUR 363
Description: Mouse polyclonal to Nidogen 2

Human NID1/ Nidogen-1 ELISA Kit

E1745Hu 1 Kit
EUR 563

Human Nidogen- 1, NID1 ELISA KIT

ELI-03424h 96 Tests
EUR 824

ELISA kit for Human NID (Nidogen)

ELK3637 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Nidogen (NID). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Nidogen (NID). Next,
  • Show more
Description: A sandwich ELISA kit for detection of Nidogen from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Nidogen 1 (NID1) ELISA Kit

CSB-E13289h-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Nidogen 1 (NID1) in samples from serum, plasma, cell culture supernates . A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Nidogen 1 (NID1) ELISA Kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitative sandwich ELISA kit for measuring Human Nidogen 1 (NID1) in samples from serum, plasma, cell culture supernates . Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Human Nidogen (NID)

KTE62218-48T 48T
EUR 332
  • Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin. Entactin (or nidogen) is a member of the nidogen fam
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nidogen (NID)

KTE62218-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin. Entactin (or nidogen) is a member of the nidogen fam
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Nidogen (NID)

KTE62218-96T 96T
EUR 539
  • Entactin (or nidogen) is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans ( heparan sulfate and glycosaminoglycans), laminin and fibronectin. Entactin (or nidogen) is a member of the nidogen fam
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Nidogen (NID) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

anti- Nidogen 2 antibody

FNab05730 100µg
EUR 505.25
  • Immunogen: nidogen 2(osteonidogen)
  • Uniprot ID: Q14112
  • Research Area: Cardiovascular
Description: Antibody raised against Nidogen 2

anti- Nidogen 2 antibody

FNab05731 100µg
EUR 505.25
  • Immunogen: nidogen 2(osteonidogen)
  • Uniprot ID: Q14112
  • Research Area: Cardiovascular
Description: Antibody raised against Nidogen 2

Nidogen 2 Blocking Peptide

  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Anti-Nidogen 2 antibody

PAab05730 100 ug
EUR 355

Anti-Nidogen 2 antibody

PAab05731 100 ug
EUR 355

Anti-Nidogen 2 (4G8)

YF-MA17728 100 ug
EUR 363
Description: Mouse monoclonal to Nidogen 2

NID2 ELISA Kit (Rat) (OKCD02713)

OKCD02713 96 Wells
EUR 896
Description: Description of target: Cell adhesion glycoprotein. Might be involved in osteoblast differentiation. It probably has a role in cell-extracellular matrix interactions. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.2 ng/mL

NID2 ELISA Kit (Mouse) (OKEH05840)

OKEH05840 96 Wells
EUR 662
Description: Description of target: Cell adhesion glycoprotein. Might be involved in osteoblast differentiation. It probably has a role in cell-extracellular matrix interactions. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.174 ng/mL

Human Nidogen (NID) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Nidogen 1/Entactin (NID1) ELISA Kit

abx251792-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NID2 Antibody

ABD9704 100 ug
EUR 438


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NID2 antibody

70R-6064 50 ug
EUR 467
Description: Rabbit polyclonal NID2 antibody

NID2 Antibody

46097-100ul 100ul
EUR 252

NID2 Antibody

46097-50ul 50ul
EUR 187

NID2 antibody

70R-18878 50 ul
EUR 435
Description: Rabbit polyclonal NID2 antibody

NID2 Antibody

DF9704 200ul
EUR 304
Description: NID2 Antibody detects endogenous levels of total NID2.

NID2 Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against NID2. Recognizes NID2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Nidogen 2 (Osteonidogen) Polyclonal Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nidogen Antibody

AF9131 200ul
EUR 304
Description: Nidogen Antibody detects endogenous levels of total Nidogen.

Nidogen Antibody

ABF9131 100 ug
EUR 438

Nidogen Antibody

44374-100ul 100ul
EUR 252

Nidogen Antibody

44374-50ul 50ul
EUR 187

Rat Nid1/ Nidogen-1 ELISA Kit

E0671Ra 1 Kit
EUR 571

Mouse Nid1/ Nidogen-1 ELISA Kit

E1026Mo 1 Kit
EUR 571

Mouse Nidogen- 1, Nid1 ELISA KIT

ELI-03422m 96 Tests
EUR 865

NID2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1427103 1.0 ug DNA
EUR 154


AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human NID2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NID-1(Nidogen-1/Entactin) ELISA Kit

EH0243 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P14543
  • Alias: Nidogen-1/Entactin/NID-1/Entactin-1/NID1/NIDentactin/nidogen(enactin)/nidogen 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Nidogen-1/Entactin/NID-1 ELISA Kit

LF-EK50935 1×96T
EUR 648

Human Nidogen (NID) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Nidogen 1/Entactin (NID1) ELISA Kit

abx514944-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Nidogen 1/Entactin (NID1) ELISA Kit

abx514945-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

NID2 Conjugated Antibody

C46097 100ul
EUR 397

NID2 cloning plasmid

CSB-CL614513HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2910
  • Sequence: atggagggggaccgggtggccgggcggccggtgctgtcgtcgttaccagtgctactgctgctgcagttgctaatgttgcgggccgcggcgctgcacccagacgagctcttcccacacggggagtcgtggggggaccagctcctgcaggaaggcgacgacgaaagctcagccgtgg
  • Show more
Description: A cloning plasmid for the NID2 gene.

NID2 Polyclonal Antibody

ES9927-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NID2 Polyclonal Antibody

ES9927-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NID2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

NID2 Polyclonal Antibody

ABP59465-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
  • Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

NID2 Polyclonal Antibody

ABP59465-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
  • Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

NID2 Polyclonal Antibody

ABP59465-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780
  • Applications tips:
Description: A polyclonal antibody for detection of NID2 from Human. This NID2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NID2 protein at amino acid sequence of 700-780

NID2 Blocking Peptide

33R-1881 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NID2 antibody, catalog no. 70R-6064

NID2 Blocking Peptide

DF9704-BP 1mg
EUR 195

Anti-NID2 antibody

STJ191085 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NID2

ELISA kit for Human Nidogen-1/Entactin/NID-1

EK5386 96 tests
EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Nidogen-1/Entactin/NID-1 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human Nidogen-1/Entactin/NID-1 PicoKine ELISA Kit

EK0856 96 wells
EUR 425
Description: For quantitative detection of human Nidogen-1 in cell culture supernates and serum.

Nidogen-1/Entactin/NID-1 ELISA Kit (Human) (OKBB00454)

OKBB00454 96 Wells
EUR 505
Description: Description of target: Nidogen-1 (NID-1), also known as Entactin, is a protein that in humans is encoded by the NID1 gene. It is a member of the nidogen family of basement membrane glycoproteins. This gene is mapped to 1q42.3. Nidogen-1 is a component of the basement membrane alongside other components such as collagen type IV, proteoglycans (heparan sulfate and glycosaminoglycans), laminin and fibronectin. The protein interacts with several other components of basement membranes. Structurally it (along with perlecan) connects the networks formed by collagens and laminins to each other. It may also play a role in cell interactions with the extracellular matrix. Nidogen-1 also can serve as a bridge between the 2 most abundant molecules in the basement membrane: type IV collagen and laminin.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Nidogen Blocking Peptide

AF9131-BP 1mg
EUR 195

Nidogen Conjugated Antibody

C44374 100ul
EUR 397

Nidogen Polyclonal Antibody

ES6392-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Nidogen from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nidogen Polyclonal Antibody

ES6392-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Nidogen from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Nidogen (NID) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Nidogen Polyclonal Antibody

ABP55393-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270

Nidogen Polyclonal Antibody

ABP55393-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270

Nidogen Polyclonal Antibody

ABP55393-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270
  • Applications tips:
Description: A polyclonal antibody for detection of Nidogen from Human, Mouse, Rat. This Nidogen antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human Nidogen at AA range: 190-270

Nidogen (NID) Antibody

  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Nidogen (NID1) Antibody

  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Nidogen (NID)

  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P14543
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.6kDa
  • Isoelectric Point: 6.3
Description: Recombinant Human Nidogen expressed in: E.coli

Anti-Nidogen antibody

STJ94491 200 µl
EUR 197
Description: Rabbit polyclonal to Nidogen.

NID2 ORF Vector (Human) (pORF)

ORF007075 1.0 ug DNA
EUR 95

Nid2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3848803 1.0 ug DNA
EUR 154

Nid2 sgRNA CRISPR Lentivector (Rat) (Target 2)

K6291203 1.0 ug DNA
EUR 154

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat NID2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse NID2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

NID2 sgRNA CRISPR Lentivector set (Human)

K1427101 3 x 1.0 ug
EUR 339

Nidogen 1 (NID1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen 1 (NID1) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen-1 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen-1 Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen 1 (NID1) Antibody

  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Nidogen 1 Blocking Peptide

  • EUR 286.00
  • EUR 425.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Nidogen-1 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen-1 Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen-1 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Nidogen-1 Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Mouse Nidogen-1 (Nid1)

  • EUR 586.00
  • EUR 299.00
  • EUR 2172.00
  • EUR 900.00
  • EUR 1442.00
  • EUR 382.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 28.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Nidogen-1(Nid1) ,partial expressed in Yeast

Mouse Nidogen-1 (Nid1)

  • EUR 703.00
  • EUR 415.00
  • EUR 2288.00
  • EUR 1016.00
  • EUR 1558.00
  • EUR 498.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 26.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Nidogen-1(Nid1),partial expressed in Yeast

Mouse Nidogen-1 (Nid1)

  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 30.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Nidogen-1(Nid1),partial expressed in E.coli

Nidogen (NID) Polyclonal Antibody (Human, Mouse)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NID (Ala971~Cys1219)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Mouse Nidogen (NID)

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Human NID2(Nidogen 2) ELISA Kit