Human MFI2(Melanotransferrin) ELISA Kit
Human MFI2(Melanotransferrin) ELISA Kit
Human Melanotransferrin (MFI2) ELISA Kit |
RD-MFI2-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
Human Melanotransferrin (MFI2)ELISA Kit |
201-12-2492 |
SunredBio |
96 tests |
EUR 440 |
- This Melanotransferrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Melanotransferrin(MFI2) ELISA kit |
CSB-EL013754HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin (MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Melanotransferrin(MFI2) ELISA kit |
1-CSB-EL013754HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin(MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Human MFI2(Melanotransferrin) ELISA Kit |
EH3348 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 31.25-2000 pg/ml
- Uniprot ID: P08582
- Alias: MFI2/CD228/MAP97/MFI2/MTF/p97/antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and96.5/CD228/CD228 antigen/FLJ38863/MAP97Melanoma-associated antigen p97/melanotrans
- Show more
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Melanotransferrin (MFI2) ELISA Kit |
SEB677Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4502.43 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
Human Melanotransferrin (MFI2) ELISA Kit |
SEB677Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 458.44 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
Human Melanotransferrin (MFI2) ELISA Kit |
SEB677Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 612.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
Human Melanotransferrin (MFI2) ELISA Kit |
SEB677Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2454.23 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids. |
Human Melanotransferrin (MFI2) ELISA Kit |
4-SEB677Hu |
Cloud-Clone |
-
EUR 4553.00
-
EUR 2405.00
-
EUR 613.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Melanotransferrin elisa. Alternative names of the recognized antigen: CD228
- MAP97
- MTF1
- Antigen P97(Melanoma Associated)
- Membrane-Bound Transferrin-Like Protein
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Melanotransferrin (MFI2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Rabbit Melanotransferrin (Mfi2) |
1-CSB-EP013754RB |
Cusabio |
-
EUR 611.00
-
EUR 309.00
-
EUR 1827.00
-
EUR 939.00
-
EUR 1218.00
-
EUR 397.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 91.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Rabbit Melanotransferrin(Mfi2),partial expressed in E.coli |
Melanotransferrin (MFI2) Antibody |
20-abx005099 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Melanotransferrin (Mfi2) Antibody |
20-abx111013 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Melanotransferrin (MFI2) Antibody |
20-abx128153 |
Abbexa |
-
EUR 411.00
-
EUR 133.00
-
EUR 1149.00
-
EUR 565.00
-
EUR 314.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Melanotransferrin (MFI2) Antibody |
20-abx173530 |
Abbexa |
|
|
|
Melanotransferrin (MFI2) Antibody |
abx235149-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Recombinant Melanotransferrin (MFI2) |
4-RPB677Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P08582
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 41.3kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Melanotransferrin expressed in: E.coli |
ELISA kit for Human MFI2 (Melanotransferrin) |
E-EL-H2405 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's MFI2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human MFI2 (Melanotransferrin) |
ELK3234 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Melanotransferrin (MFI2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Melanotra
- Show more
|
Description: A sandwich ELISA kit for detection of Melanotransferrin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Melanotransferrin (MFI2) |
KTE61638-48T |
Abbkine |
48T |
EUR 332 |
- Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Melanotransferrin (MFI2) |
KTE61638-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Melanotransferrin (MFI2) |
KTE61638-96T |
Abbkine |
96T |
EUR 539 |
- Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Melanotransferrin (MFI2) CLIA Kit |
abx197271-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Melanotransferrin (MFI2) CLIA Kit |
20-abx492980 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Melanotransferrin (MFI2) Protein |
20-abx167031 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
ELISA kit for Rabbit Melanotransferrin (MFI2) |
KTE90099-48T |
Abbkine |
48T |
EUR 354 |
- The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Melanotransferrin (MFI2) |
KTE90099-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rabbit Melanotransferrin (MFI2) |
KTE90099-96T |
Abbkine |
96T |
EUR 572 |
- The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
- Show more
|
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Melanotransferrin (MFI2) |
KTE71043-48T |
Abbkine |
48T |
EUR 332 |
- The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Melanotransferrin (MFI2) |
KTE71043-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Melanotransferrin (MFI2) |
KTE71043-96T |
Abbkine |
96T |
EUR 539 |
- The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
CLIA kit for Human MFI2 (Melanotransferrin) |
E-CL-H1410 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's MFI2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2 . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant |
Melanotransferrin (MFI2) Polyclonal Antibody (Human) |
4-PAB677Hu01 |
Cloud-Clone |
-
EUR 239.00
-
EUR 2391.00
-
EUR 598.00
-
EUR 299.00
-
EUR 211.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2) |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC |
4-PAB677Hu01-APC |
Cloud-Clone |
-
EUR 333.00
-
EUR 3113.00
-
EUR 872.00
-
EUR 423.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC. |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), Biotinylated |
4-PAB677Hu01-Biotin |
Cloud-Clone |
-
EUR 303.00
-
EUR 2341.00
-
EUR 697.00
-
EUR 369.00
-
EUR 216.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Biotin. |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), Cy3 |
4-PAB677Hu01-Cy3 |
Cloud-Clone |
-
EUR 403.00
-
EUR 4109.00
-
EUR 1121.00
-
EUR 523.00
-
EUR 245.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Cy3. |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), FITC |
4-PAB677Hu01-FITC |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with FITC. |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), HRP |
4-PAB677Hu01-HRP |
Cloud-Clone |
-
EUR 305.00
-
EUR 2714.00
-
EUR 772.00
-
EUR 383.00
-
EUR 203.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with HRP. |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), PE |
4-PAB677Hu01-PE |
Cloud-Clone |
-
EUR 287.00
-
EUR 2510.00
-
EUR 717.00
-
EUR 359.00
-
EUR 192.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with PE. |
Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC-Cy7 |
4-PAB677Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 547.00
-
EUR 6106.00
-
EUR 1624.00
-
EUR 727.00
-
EUR 310.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: MFI2 (Leu366~Ser706)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC-Cy7. |
Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-100ug |
QP6357-ec-100ug |
EnQuireBio |
100ug |
EUR 707 |
Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-10ug |
QP6357-ec-10ug |
EnQuireBio |
10ug |
EUR 326 |
Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-1mg |
QP6357-ec-1mg |
EnQuireBio |
1mg |
EUR 2303 |
Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-200ug |
QP6357-ec-200ug |
EnQuireBio |
200ug |
EUR 1115 |
Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-500ug |
QP6357-ec-500ug |
EnQuireBio |
500ug |
EUR 1514 |
Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-50ug |
QP6357-ec-50ug |
EnQuireBio |
50ug |
EUR 435 |
Human Melanotransferrin (MELTF) ELISA Kit |
20-abx152303 |
Abbexa |
-
EUR 7112.00
-
EUR 3792.00
-
EUR 879.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Melanotransferrin (MELTF) ELISA Kit |
abx252749-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Chicken Melanotransferrin (MELTF) ELISA Kit |
abx354703-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Melanotransferrin (MELTF) ELISA Kit |
abx355024-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Melanotransferrin (MELTF) ELISA Kit |
abx355170-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Melanotransferrin (MELTF) ELISA Kit |
abx355246-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Melanotransferrin (MELTF) ELISA Kit |
abx355389-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
MFI2 antibody |
70R-18494 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal MFI2 antibody |
MFI2 antibody |
70R-10040 |
Fitzgerald |
50 ug |
EUR 467 |
Description: Affinity purified rabbit polyclonal MFI2 antibody |
MFI2 antibody |
39073-100ul |
SAB |
100ul |
EUR 252 |
MFI2 Antibody |
1-CSB-PA013754GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against MFI2. Recognizes MFI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
MFI2 siRNA |
20-abx924039 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
MFI2 siRNA |
20-abx924040 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-MFI2 |
YF-PA13138 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to MFI2 |
Human MFI2 shRNA Plasmid |
20-abx952883 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MFI2 Recombinant Protein (Human) |
RP019246 |
ABM |
100 ug |
Ask for price |
MFI2 Blocking Peptide |
33R-1830 |
Fitzgerald |
100 ug |
EUR 180 |
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFI2 antibody, catalog no. 70R-10040 |
MFI2 Conjugated Antibody |
C39073 |
SAB |
100ul |
EUR 397 |
MFI2 cloning plasmid |
CSB-CL013754HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 909
- Sequence: atgcggggtccgagcggggctctgtggctgctcctggctctgcgcaccgtgctcggtggcatggaggtgcggtggtgcgccacctcggacccagagcagcacaagtgcggcaacatgagcgaggccttccgggaagcgggcatccagccctccctcctctgcgtccggggcacctc
- Show more
|
Description: A cloning plasmid for the MFI2 gene. |
MFI2 Rabbit pAb |
A6653-100ul |
Abclonal |
100 ul |
EUR 308 |
MFI2 Rabbit pAb |
A6653-200ul |
Abclonal |
200 ul |
EUR 459 |
MFI2 Rabbit pAb |
A6653-20ul |
Abclonal |
20 ul |
EUR 183 |
MFI2 Rabbit pAb |
A6653-50ul |
Abclonal |
50 ul |
EUR 223 |
anti- MFI2 antibody |
FNab05149 |
FN Test |
100µg |
EUR 548.75 |
- Immunogen: antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
- Uniprot ID: P08582
- Research Area: Immunology
|
Description: Antibody raised against MFI2 |
Anti-MFI2 antibody |
STJ28736 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants. |
Anti-MFI2 (1F7) |
YF-MA14236 |
Abfrontier |
200 ul |
EUR 363 |
Description: Mouse monoclonal to MFI2 |
MFI2 ORF Vector (Human) (pORF) |
ORF006416 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Mouse MFI2 shRNA Plasmid |
20-abx974022 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
MFI2 Recombinant Protein (Mouse) |
RP150407 |
ABM |
100 ug |
Ask for price |
MFI2 Recombinant Protein (Rat) |
RP211520 |
ABM |
100 ug |
Ask for price |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
MFI2 sgRNA CRISPR Lentivector set (Human) |
K1296301 |
ABM |
3 x 1.0 ug |
EUR 339 |
MFI2-AS1 ORF Vector (Human) (pORF) |
ORF023512 |
ABM |
1.0 ug DNA |
Ask for price |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Mfi2 ORF Vector (Rat) (pORF) |
ORF070508 |
ABM |
1.0 ug DNA |
EUR 506 |
Mfi2 ORF Vector (Mouse) (pORF) |
ORF050137 |
ABM |
1.0 ug DNA |
EUR 506 |
MFI2 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1296302 |
ABM |
1.0 ug DNA |
EUR 154 |
MFI2 sgRNA CRISPR Lentivector (Human) (Target 2) |
K1296303 |
ABM |
1.0 ug DNA |
EUR 154 |
MFI2 sgRNA CRISPR Lentivector (Human) (Target 3) |
K1296304 |
ABM |
1.0 ug DNA |
EUR 154 |
MFI2 Protein Vector (Human) (pPB-C-His) |
PV025661 |
ABM |
500 ng |
EUR 329 |
MFI2 Protein Vector (Human) (pPB-N-His) |
PV025662 |
ABM |
500 ng |
EUR 329 |
MFI2 Protein Vector (Human) (pPM-C-HA) |
PV025663 |
ABM |
500 ng |
EUR 329 |
MFI2 Protein Vector (Human) (pPM-C-His) |
PV025664 |
ABM |
500 ng |
EUR 329 |
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Human MFI2(Melanotransferrin) ELISA Kit