Human MFI2(Melanotransferrin) ELISA Kit

Human MFI2(Melanotransferrin) ELISA Kit

Human Melanotransferrin (MFI2) ELISA Kit

RD-MFI2-Hu-96Tests 96 Tests
EUR 692

Human Melanotransferrin (MFI2)ELISA Kit

201-12-2492 96 tests
EUR 440
  • This Melanotransferrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Melanotransferrin(MFI2) ELISA kit

CSB-EL013754HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin (MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Melanotransferrin(MFI2) ELISA kit

1-CSB-EL013754HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Melanotransferrin(MFI2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human MFI2(Melanotransferrin) ELISA Kit

EH3348 96T
EUR 524.1
  • Detection range: 31.25-2000 pg/ml
  • Uniprot ID: P08582
  • Alias: MFI2/CD228/MAP97/MFI2/MTF/p97/antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and96.5/CD228/CD228 antigen/FLJ38863/MAP97Melanoma-associated antigen p97/melanotrans
  • Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Melanotransferrin, MFI2 ELISA KIT

ELI-51146h 96 Tests
EUR 824

Human Melanotransferrin(MFI2)ELISA Kit

QY-E03122 96T
EUR 361

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-10x96wellstestplate 10x96-wells test plate
EUR 4502.43
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-1x48wellstestplate 1x48-wells test plate
EUR 458.44
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-1x96wellstestplate 1x96-wells test plate
EUR 612.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

SEB677Hu-5x96wellstestplate 5x96-wells test plate
EUR 2454.23
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Melanotransferrin (MFI2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Melanotransferrin (MFI2) in serum, plasma and other biological fluids.

Human Melanotransferrin (MFI2) ELISA Kit

4-SEB677Hu
  • EUR 4553.00
  • EUR 2405.00
  • EUR 613.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Melanotransferrin elisa. Alternative names of the recognized antigen: CD228
  • MAP97
  • MTF1
  • Antigen P97(Melanoma Associated)
  • Membrane-Bound Transferrin-Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Melanotransferrin (MFI2) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rabbit Melanotransferrin, Mfi2 ELISA KIT

ELI-28974Ra 96 Tests
EUR 928

Mouse Melanotransferrin, Mfi2 ELISA KIT

ELI-45742m 96 Tests
EUR 865

Rat Melanotransferrin(MFI2)ELISA Kit

QY-E10590 96T
EUR 361

Mouse Melanotransferrin(MFI2)ELISA Kit

QY-E20987 96T
EUR 361

Rabbit Melanotransferrin (Mfi2)

1-CSB-EP013754RB
  • EUR 611.00
  • EUR 309.00
  • EUR 1827.00
  • EUR 939.00
  • EUR 1218.00
  • EUR 397.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 91.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rabbit Melanotransferrin(Mfi2),partial expressed in E.coli

Melanotransferrin (MFI2) Antibody

20-abx005099
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanotransferrin (Mfi2) Antibody

20-abx111013
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Melanotransferrin (MFI2) Antibody

20-abx128153
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Melanotransferrin (MFI2) Antibody

20-abx173530
  • EUR 815.00
  • EUR 425.00
  • 1 mg
  • 200 ug
  • Please enquire.

Melanotransferrin (MFI2) Antibody

abx235149-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Melanotransferrin (MFI2)

4-RPB677Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P08582
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 41.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Melanotransferrin expressed in: E.coli

ELISA kit for Human MFI2 (Melanotransferrin)

E-EL-H2405 1 plate of 96 wells
EUR 534
  • Gentaur's MFI2 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human MFI2 (Melanotransferrin)

ELK3234 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Melanotransferrin (MFI2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Melanotra
  • Show more
Description: A sandwich ELISA kit for detection of Melanotransferrin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Melanotransferrin (MFI2)

KTE61638-48T 48T
EUR 332
  • Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Melanotransferrin (MFI2)

KTE61638-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Melanotransferrin (MFI2)

KTE61638-96T 96T
EUR 539
  • Melanotransferrin encoded by MFI2 is a cell-surface glycoprotein found on melanoma cells. Melanotransferrin shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding functio
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Melanotransferrin (MFI2) CLIA Kit

abx197271-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Melanotransferrin (MFI2) CLIA Kit

20-abx492980
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Melanotransferrin (MFI2) Protein

20-abx167031
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Rabbit Melanotransferrin (MFI2)

KTE90099-48T 48T
EUR 354
  • The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Melanotransferrin (MFI2)

KTE90099-5platesof96wells 5 plates of 96 wells
EUR 2252
  • The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Melanotransferrin (MFI2)

KTE90099-96T 96T
EUR 572
  • The protein encoded by Melanotransferrin (MFI2) is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding
  • Show more
Description: Quantitative sandwich ELISA for measuring Rabbit Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Melanotransferrin (MFI2)

KTE71043-48T 48T
EUR 332
  • The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Melanotransferrin (MFI2)

KTE71043-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Melanotransferrin (MFI2)

KTE71043-96T 96T
EUR 539
  • The protein encoded by MELTF is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not y
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Melanotransferrin (MFI2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

CLIA kit for Human MFI2 (Melanotransferrin)

E-CL-H1410 1 plate of 96 wells
EUR 584
  • Gentaur's MFI2 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human MFI2 . Standards or samples are added to the micro CLIA plate wells and combined with the
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human MFI2 (Melanotransferrin) in samples from Serum, Plasma, Cell supernatant

Melanotransferrin (MFI2) Polyclonal Antibody (Human)

4-PAB677Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2)

Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC

4-PAB677Hu01-APC
  • EUR 333.00
  • EUR 3113.00
  • EUR 872.00
  • EUR 423.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), Biotinylated

4-PAB677Hu01-Biotin
  • EUR 303.00
  • EUR 2341.00
  • EUR 697.00
  • EUR 369.00
  • EUR 216.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Biotin.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), Cy3

4-PAB677Hu01-Cy3
  • EUR 403.00
  • EUR 4109.00
  • EUR 1121.00
  • EUR 523.00
  • EUR 245.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with Cy3.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), FITC

4-PAB677Hu01-FITC
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with FITC.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), HRP

4-PAB677Hu01-HRP
  • EUR 305.00
  • EUR 2714.00
  • EUR 772.00
  • EUR 383.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with HRP.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), PE

4-PAB677Hu01-PE
  • EUR 287.00
  • EUR 2510.00
  • EUR 717.00
  • EUR 359.00
  • EUR 192.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with PE.

Melanotransferrin (MFI2) Polyclonal Antibody (Human), APC-Cy7

4-PAB677Hu01-APC-Cy7
  • EUR 547.00
  • EUR 6106.00
  • EUR 1624.00
  • EUR 727.00
  • EUR 310.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: MFI2 (Leu366~Ser706)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Melanotransferrin (MFI2). This antibody is labeled with APC-Cy7.

MFI2 ELISA KIT|Human

EF006974 96 Tests
EUR 689

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-100ug

QP6357-ec-100ug 100ug
EUR 707

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-10ug

QP6357-ec-10ug 10ug
EUR 326

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-1mg

QP6357-ec-1mg 1mg
EUR 2303

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-200ug

QP6357-ec-200ug 200ug
EUR 1115

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-500ug

QP6357-ec-500ug 500ug
EUR 1514

Recombinant Rabbit MFI2/ CD228/ melanotransferrin Protein, His-SUMO, E.coli-50ug

QP6357-ec-50ug 50ug
EUR 435

Human Melanotransferrin (MELTF) ELISA Kit

20-abx152303
  • EUR 7112.00
  • EUR 3792.00
  • EUR 879.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Melanotransferrin (MELTF) ELISA Kit

abx252749-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Chicken Melanotransferrin (MELTF) ELISA Kit

abx354703-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Monkey Melanotransferrin (MELTF) ELISA Kit

abx355024-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Pig Melanotransferrin (MELTF) ELISA Kit

abx355170-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Melanotransferrin (MELTF) ELISA Kit

abx355246-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Sheep Melanotransferrin (MELTF) ELISA Kit

abx355389-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

MFI2 antibody

70R-18494 50 ul
EUR 435
Description: Rabbit polyclonal MFI2 antibody

MFI2 antibody

70R-10040 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MFI2 antibody

MFI2 antibody

39073-100ul 100ul
EUR 252

MFI2 Antibody

1-CSB-PA013754GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MFI2. Recognizes MFI2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MFI2 siRNA

20-abx924039
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MFI2 siRNA

20-abx924040
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-MFI2

YF-PA13138 50 ug
EUR 363
Description: Mouse polyclonal to MFI2

Human MFI2 shRNA Plasmid

20-abx952883
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFI2 Recombinant Protein (Human)

RP019246 100 ug Ask for price

MFI2 Blocking Peptide

33R-1830 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MFI2 antibody, catalog no. 70R-10040

MFI2 Conjugated Antibody

C39073 100ul
EUR 397

MFI2 cloning plasmid

CSB-CL013754HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 909
  • Sequence: atgcggggtccgagcggggctctgtggctgctcctggctctgcgcaccgtgctcggtggcatggaggtgcggtggtgcgccacctcggacccagagcagcacaagtgcggcaacatgagcgaggccttccgggaagcgggcatccagccctccctcctctgcgtccggggcacctc
  • Show more
Description: A cloning plasmid for the MFI2 gene.

MFI2 Rabbit pAb

A6653-100ul 100 ul
EUR 308

MFI2 Rabbit pAb

A6653-200ul 200 ul
EUR 459

MFI2 Rabbit pAb

A6653-20ul 20 ul
EUR 183

MFI2 Rabbit pAb

A6653-50ul 50 ul
EUR 223

anti- MFI2 antibody

FNab05149 100µg
EUR 548.75
  • Immunogen: antigen p97(melanoma associated) identified by monoclonal antibodies 133.2 and 96.5
  • Uniprot ID: P08582
  • Research Area: Immunology
Description: Antibody raised against MFI2

Anti-MFI2 antibody

PAab05149 100 ug
EUR 386

Anti-MFI2 antibody

STJ28736 100 µl
EUR 277
Description: The protein encoded by this gene is a cell-surface glycoprotein found on melanoma cells. The protein shares sequence similarity and iron-binding properties with members of the transferrin superfamily. The importance of the iron binding function has not yet been identified. This gene resides in the same region of chromosome 3 as members of the transferrin superfamily. Alternative splicing results in two transcript variants.

Anti-MFI2 (1F7)

YF-MA14236 200 ul
EUR 363
Description: Mouse monoclonal to MFI2

MFI2 ORF Vector (Human) (pORF)

ORF006416 1.0 ug DNA
EUR 95

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Mouse MFI2 shRNA Plasmid

20-abx974022
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

MFI2 Recombinant Protein (Mouse)

RP150407 100 ug Ask for price

MFI2 Recombinant Protein (Rat)

RP211520 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

MFI2 sgRNA CRISPR Lentivector set (Human)

K1296301 3 x 1.0 ug
EUR 339

MFI2-AS1 ORF Vector (Human) (pORF)

ORF023512 1.0 ug DNA Ask for price

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Mfi2 ORF Vector (Rat) (pORF)

ORF070508 1.0 ug DNA
EUR 506

Mfi2 ORF Vector (Mouse) (pORF)

ORF050137 1.0 ug DNA
EUR 506

MFI2 sgRNA CRISPR Lentivector (Human) (Target 1)

K1296302 1.0 ug DNA
EUR 154

MFI2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1296303 1.0 ug DNA
EUR 154

MFI2 sgRNA CRISPR Lentivector (Human) (Target 3)

K1296304 1.0 ug DNA
EUR 154

MFI2 Protein Vector (Human) (pPB-C-His)

PV025661 500 ng
EUR 329

MFI2 Protein Vector (Human) (pPB-N-His)

PV025662 500 ng
EUR 329

MFI2 Protein Vector (Human) (pPM-C-HA)

PV025663 500 ng
EUR 329

MFI2 Protein Vector (Human) (pPM-C-His)

PV025664 500 ng
EUR 329

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Human MFI2(Melanotransferrin) ELISA Kit