Human KRT2(Keratin 2) ELISA Kit

Human KRT2(Keratin 2) ELISA Kit

Human Keratin 2 (KRT2) ELISA Kit

RD-KRT2-Hu-48Tests 48 Tests
EUR 478

Human Keratin 2 (KRT2) ELISA Kit

RD-KRT2-Hu-96Tests 96 Tests
EUR 662

Human Keratin 2 (KRT2) ELISA Kit

RDR-KRT2-Hu-48Tests 48 Tests
EUR 500

Human Keratin 2 (KRT2) ELISA Kit

RDR-KRT2-Hu-96Tests 96 Tests
EUR 692

Human Keratin 2 (KRT2) ELISA Kit

20-abx152111
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Keratin 2 (KRT2) ELISA Kit

abx250879-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Keratin 2(KRT2)ELISA Kit

201-12-3211 96 tests
EUR 440
  • This Keratin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Keratin 2 (KRT2) ELISA Kit

SEA491Hu-10x96wellstestplate 10x96-wells test plate
EUR 4273.35
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit

SEA491Hu-1x48wellstestplate 1x48-wells test plate
EUR 439.57
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit

SEA491Hu-1x96wellstestplate 1x96-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit

SEA491Hu-5x96wellstestplate 5x96-wells test plate
EUR 2332.95
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit

4-SEA491Hu
  • EUR 4324.00
  • EUR 2283.00
  • EUR 586.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Keratin 2 elisa. Alternative names of the recognized antigen: KRT2A
  • CK2
  • KRTE
  • Cytokeratin 2
  • Keratin 2A
  • Keratin 2E
  • Epidermal Ichthyosis Bullosa Of Siemens
  • Keratin, type II cytoskeletal 2 epidermal
  • Epithelial keratin-2e
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 2 (KRT2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Keratin 2 ELISA Kit (KRT2)

RK01745 96 Tests
EUR 521

Human Keratin 2(KRT2)ELISA Kit

QY-E00974 96T
EUR 361

Dog Keratin 2 (KRT2) ELISA Kit

abx516851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Keratin 2 (KRT2) ELISA Kit

abx516853-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Keratin 2 (KRT2) ELISA Kit

abx516854-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Mouse Keratin 2(KRT2)ELISA Kit

GA-E0855MS-48T 48T
EUR 336

Mouse Keratin 2(KRT2)ELISA Kit

GA-E0855MS-96T 96T
EUR 534

Rat KeRatin 2(KRT2)ELISA Kit

QY-E10611 96T
EUR 361

ELISA kit for Human KRT2 (Keratin 2)

ELK3602 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 2 (KRT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 2 (KRT2).
  • Show more
Description: A sandwich ELISA kit for detection of Keratin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Keratin 2 (KRT2) CLIA Kit

20-abx491555
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Keratin 2 (KRT2) Antibody

20-abx129632
  • EUR 411.00
  • EUR 133.00
  • EUR 1135.00
  • EUR 551.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody

20-abx100356
  • EUR 300.00
  • EUR 133.00
  • EUR 759.00
  • EUR 398.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody

20-abx100357
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody

20-abx100358
  • EUR 425.00
  • EUR 133.00
  • EUR 1177.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody

20-abx173248
  • EUR 314.00
  • EUR 787.00
  • EUR 411.00
  • EUR 154.00
  • EUR 258.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-12 working days.

Recombinant Keratin 2 (KRT2)

4-RPA491Hu01
  • EUR 431.52
  • EUR 218.00
  • EUR 1343.20
  • EUR 514.40
  • EUR 928.80
  • EUR 352.00
  • EUR 3208.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P35908
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 15.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Keratin 2 expressed in: E.coli

Recombinant Keratin 2 (KRT2)

4-RPA491Mu01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q3TTY5
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 39.8kDa
  • Isoelectric Point: 5.4
Description: Recombinant Mouse Keratin 2 expressed in: E.coli

Recombinant Keratin 2 (KRT2)

4-RPA491Ra01
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6IG02
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 21.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 2 expressed in: E.coli

Recombinant Keratin 2 (KRT2)

4-RPA491Ra02
  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6IG02
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 2 expressed in: E.coli

Human Keratin 2 (KRT2) Protein

20-abx067618
  • EUR 606.00
  • EUR 258.00
  • EUR 1817.00
  • EUR 718.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Keratin 2 (KRT2) Protein

20-abx067619
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Rat Keratin 2 (KRT2) Protein

20-abx067620
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Keratin 2 (KRT2) Protein

20-abx167202
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody (Biotin)

20-abx273325
  • EUR 481.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 662.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Keratin 2 (KRT2) Polyclonal Antibody (Human)

4-PAA491Hu01
  • EUR 232.00
  • EUR 2285.00
  • EUR 574.00
  • EUR 289.00
  • EUR 208.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2)

Keratin 2 (KRT2) Polyclonal Antibody (Human), APC

4-PAA491Hu01-APC
  • EUR 323.00
  • EUR 2969.00
  • EUR 836.00
  • EUR 409.00
  • EUR 210.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Human), Biotinylated

4-PAA491Hu01-Biotin
  • EUR 295.00
  • EUR 2235.00
  • EUR 671.00
  • EUR 358.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Human), Cy3

4-PAA491Hu01-Cy3
  • EUR 390.00
  • EUR 3917.00
  • EUR 1073.00
  • EUR 504.00
  • EUR 239.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Human), FITC

4-PAA491Hu01-FITC
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Human), HRP

4-PAA491Hu01-HRP
  • EUR 297.00
  • EUR 2589.00
  • EUR 741.00
  • EUR 371.00
  • EUR 199.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Human), PE

4-PAA491Hu01-PE
  • EUR 279.00
  • EUR 2395.00
  • EUR 688.00
  • EUR 347.00
  • EUR 188.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with PE.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat)

4-PAA491Ra01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2)

Keratin 2 (KRT2) Polyclonal Antibody (Mouse)

4-PAA491Mu01
  • EUR 236.00
  • EUR 2338.00
  • EUR 586.00
  • EUR 294.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2)

Keratin 2 (KRT2) Polyclonal Antibody (Rat)

4-PAA491Ra02
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2)

Human KRT2/ Keratin, type II cytoskeletal 2 epidermal ELISA Kit

E1404Hu 1 Kit
EUR 571

Human KRT2(Keratin, type II cytoskeletal 2 epidermal) ELISA Kit

EH1589 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P35908
  • Alias: KRT2/Keratin, type II cytoskeletal 2 epiderma/Type-II keratin Kb2/Keratin-2e/K2e/Keratin-2 epidermis/Cytokeratin-2e/CK-2e/Epithelial keratin-2e/KRT2A/KRT2E/KRTE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Keratin, type II cytoskeletal 2 epidermal, KRT2 ELISA KIT

ELI-04653h 96 Tests
EUR 824

Keratin 2 (KRT2) Polyclonal Antibody (Human), APC-Cy7

4-PAA491Hu01-APC-Cy7
  • EUR 527.00
  • EUR 5818.00
  • EUR 1552.00
  • EUR 698.00
  • EUR 301.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Cys7~Leu160)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), APC

4-PAA491Ra01-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), Biotinylated

4-PAA491Ra01-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), Cy3

4-PAA491Ra01-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), FITC

4-PAA491Ra01-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), HRP

4-PAA491Ra01-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), PE

4-PAA491Ra01-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with PE.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), APC

4-PAA491Mu01-APC
  • EUR 329.00
  • EUR 3041.00
  • EUR 854.00
  • EUR 416.00
  • EUR 212.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), Biotinylated

4-PAA491Mu01-Biotin
  • EUR 299.00
  • EUR 2288.00
  • EUR 684.00
  • EUR 363.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), Cy3

4-PAA491Mu01-Cy3
  • EUR 397.00
  • EUR 4013.00
  • EUR 1097.00
  • EUR 513.00
  • EUR 241.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), FITC

4-PAA491Mu01-FITC
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), HRP

4-PAA491Mu01-HRP
  • EUR 302.00
  • EUR 2652.00
  • EUR 756.00
  • EUR 377.00
  • EUR 200.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), PE

4-PAA491Mu01-PE
  • EUR 283.00
  • EUR 2452.00
  • EUR 703.00
  • EUR 353.00
  • EUR 189.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with PE.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), APC

4-PAA491Ra02-APC
  • EUR 340.00
  • EUR 3203.00
  • EUR 894.00
  • EUR 432.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), Biotinylated

4-PAA491Ra02-Biotin
  • EUR 307.00
  • EUR 2407.00
  • EUR 714.00
  • EUR 375.00
  • EUR 217.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), Cy3

4-PAA491Ra02-Cy3
  • EUR 411.00
  • EUR 4229.00
  • EUR 1151.00
  • EUR 535.00
  • EUR 248.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), FITC

4-PAA491Ra02-FITC
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), HRP

4-PAA491Ra02-HRP
  • EUR 311.00
  • EUR 2792.00
  • EUR 791.00
  • EUR 391.00
  • EUR 205.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), PE

4-PAA491Ra02-PE
  • EUR 292.00
  • EUR 2582.00
  • EUR 735.00
  • EUR 366.00
  • EUR 194.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with PE.

Mouse Keratin, type II cytoskeletal 2 epidermal, Krt2 ELISA KIT

ELI-04652m 96 Tests
EUR 865

Krt2/ Rat Krt2 ELISA Kit

ELI-04654r 96 Tests
EUR 886

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), APC-Cy7

4-PAA491Ra01-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Glu508~Arg685)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody

20-abx126071
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody

20-abx327388
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody

20-abx216486
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody

20-abx211764
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), APC-Cy7

4-PAA491Mu01-APC-Cy7
  • EUR 538.00
  • EUR 5962.00
  • EUR 1588.00
  • EUR 713.00
  • EUR 304.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Arg200~Glu508)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), APC-Cy7

4-PAA491Ra02-APC-Cy7
  • EUR 560.00
  • EUR 6286.00
  • EUR 1669.00
  • EUR 745.00
  • EUR 315.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: KRT2 (Ile368~Glu507)
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Human KRT2 ELISA Kit

ELA-E1427h 96 Tests
EUR 824

KRT2 ELISA KIT|Human

EF005745 96 Tests
EUR 689

Mouse KeMousein 2(KRT2)ELISA Kit

QY-E20878 96T
EUR 361

KRT2 ELISA Kit (Human) (OKAN05492)

OKAN05492 96 Wells
EUR 792
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

KRT2 ELISA Kit (Human) (OKCD06389)

OKCD06389 96 Wells
EUR 753
Description: Description of target: KRT2A is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma.The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

KRT2 ELISA Kit (Human) (OKEH01005)

OKEH01005 96 Wells
EUR 662
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Canine KRT2 ELISA KIT

ELI-04651d 96 Tests
EUR 928

KRT2 ELISA Kit (Mouse) (OKEH05503)

OKEH05503 96 Wells
EUR 662
Description: Description of target: Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

KRT2 ELISA Kit (Rat) (OKEH06174)

OKEH06174 96 Wells
EUR 662
Description: Description of target: Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

KRT2 siRNA

20-abx902902
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KRT2 siRNA

20-abx921979
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KRT2 siRNA

20-abx921980
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

KRT2 Antibody

35627-100ul 100ul
EUR 252

KRT2 Antibody

1-CSB-PA005499
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KRT2. Recognizes KRT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

KRT2 Antibody

1-CSB-PA443781
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT2. Recognizes KRT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

pMD19-KRT2

PVT17955 2 ug
EUR 231

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

KRT2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1165203 1.0 ug DNA
EUR 154

Human Keratin- associated protein 2- 2, KRTAP2-2 ELISA KIT

ELI-21083h 96 Tests
EUR 824

Human KRT2 shRNA Plasmid

20-abx952610
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

KRT2 Recombinant Protein (Human)

RP040489 100 ug Ask for price

Human Keratin 9 ELISA Kit

ELA-E2283h 96 Tests
EUR 824

Human Keratin 8 ELISA Kit

ELA-E2287h 96 Tests
EUR 824

Human Keratin 16 ELISA Kit

ELA-E8852h 96 Tests
EUR 824

Human Keratin 15 ELISA Kit

ELA-E8853h 96 Tests
EUR 824

Human Keratin 12 ELISA Kit

ELA-E8860h 96 Tests
EUR 824

Human Keratin 19 ELISA Kit

ELA-E9126h 96 Tests
EUR 824

Human Keratin 20 ELISA Kit

ELA-E9127h 96 Tests
EUR 824

Human Keratin 13 ELISA Kit

ELA-E9417h 96 Tests
EUR 824

Human Keratin- associated protein 10- 2, KRTAP10-2 ELISA KIT

ELI-12484h 96 Tests
EUR 824

Human Keratin- associated protein 21- 2, KRTAP21-2 ELISA KIT

ELI-12489h 96 Tests
EUR 824

Human Keratin- associated protein 22- 2, KRTAP22-2 ELISA KIT

ELI-12490h 96 Tests
EUR 824

Human Keratin- associated protein 5- 2, KRTAP5-2 ELISA KIT

ELI-12492h 96 Tests
EUR 824

Human Keratin- associated protein 6- 2, KRTAP6-2 ELISA KIT

ELI-12495h 96 Tests
EUR 824

Human Keratin- associated protein 9- 2, KRTAP9-2 ELISA KIT

ELI-14434h 96 Tests
EUR 824

Human Keratin- associated protein 4- 2, KRTAP4-2 ELISA KIT

ELI-21085h 96 Tests
EUR 824

Human Keratin- associated protein 19- 2, KRTAP19-2 ELISA KIT

ELI-08758h 96 Tests
EUR 824

Human Keratin- associated protein 20- 2, KRTAP20-2 ELISA KIT

ELI-08759h 96 Tests
EUR 824

Human Keratin- associated protein 12- 2, KRTAP12-2 ELISA KIT

ELI-37261h 96 Tests
EUR 824

Human Keratin- associated protein 3- 2, KRTAP3-2 ELISA KIT

ELI-37262h 96 Tests
EUR 824

Human Keratin- associated protein 13- 2, KRTAP13-2 ELISA KIT

ELI-43316h 96 Tests
EUR 824

KRT2 Conjugated Antibody

C35627 100ul
EUR 397

KRT2 cloning plasmid

CSB-CL012535HU-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1920
  • Sequence: ATGAGTTGTCAGATCTCTTGCAAATCTCGAGGAAGAGGAGGAGGTGGAGGAGGATTCCGGGGCTTCAGCAGCGGCTCAGCTGTGGTGTCTGGTGGAAGCCGGAGATCAACTTCCAGCTTCTCCTGCTTGAGCCGCCATGGTGGTGGTGGCGGGGGCTTCGGTGGAGGCGGCTTTG
  • Show more
Description: A cloning plasmid for the KRT2 gene.

KRT2 Rabbit pAb

A10375-100ul 100 ul
EUR 308

KRT2 Rabbit pAb

A10375-200ul 200 ul
EUR 459

KRT2 Rabbit pAb

A10375-20ul 20 ul
EUR 183

KRT2 Rabbit pAb

A10375-50ul 50 ul
EUR 223

Anti-KRT2 antibody

STJ112411 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.

Human KRT2(Keratin 2) ELISA Kit