Human KRT2(Keratin 2) ELISA Kit

Human KRT2(Keratin 2) ELISA Kit

Human Keratin 2 (KRT2) ELISA Kit
RD-KRT2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Keratin 2 (KRT2) ELISA Kit
RD-KRT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Human Keratin 2 (KRT2) ELISA Kit
RDR-KRT2-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Keratin 2 (KRT2) ELISA Kit
RDR-KRT2-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Human Keratin 2 (KRT2) ELISA Kit
20-abx152111	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Keratin 2 (KRT2) ELISA Kit
abx250879-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human Keratin 2(KRT2)ELISA Kit
201-12-3211	SunredBio	96 tests	EUR 440
This Keratin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4273.35
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 439.57
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 585.1
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit
SEA491Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2332.95
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 2 (KRT2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 2 (KRT2) in serum, plasma, tissue homogenates and other biological fluids.

Human Keratin 2 (KRT2) ELISA Kit
4-SEA491Hu	Cloud-Clone	EUR 4324.00 EUR 2283.00 EUR 586.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Keratin 2 elisa. Alternative names of the recognized antigen: KRT2A CK2 KRTE Cytokeratin 2 Keratin 2A Keratin 2E Epidermal Ichthyosis Bullosa Of Siemens Keratin, type II cytoskeletal 2 epidermal Epithelial keratin-2e
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 2 (KRT2) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Keratin 2 ELISA Kit (KRT2)
RK01745	Abclonal	96 Tests	EUR 521

Human Keratin 2(KRT2)ELISA Kit
QY-E00974	Qayee Biotechnology	96T	EUR 361

Dog Keratin 2 (KRT2) ELISA Kit
abx516851-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Keratin 2 (KRT2) ELISA Kit
abx516853-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Keratin 2 (KRT2) ELISA Kit
abx516854-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Mouse Keratin 2(KRT2)ELISA Kit
GA-E0855MS-48T	GenAsia Biotech	48T	EUR 336

Mouse Keratin 2(KRT2)ELISA Kit
GA-E0855MS-96T	GenAsia Biotech	96T	EUR 534

Rat KeRatin 2(KRT2)ELISA Kit
QY-E10611	Qayee Biotechnology	96T	EUR 361

ELISA kit for Human KRT2 (Keratin 2)
ELK3602	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 2 (KRT2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 2 (KRT2). Show more
Description: A sandwich ELISA kit for detection of Keratin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Keratin 2 (KRT2) CLIA Kit
20-abx491555	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Keratin 2 (KRT2) Antibody
20-abx129632	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody
20-abx100356	Abbexa	EUR 300.00 EUR 133.00 EUR 759.00 EUR 398.00 EUR 258.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody
20-abx100357	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody
20-abx100358	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody
20-abx173248	Abbexa	EUR 314.00 EUR 787.00 EUR 411.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Recombinant Keratin 2 (KRT2)
4-RPA491Hu01	Cloud-Clone	EUR 431.52 EUR 218.00 EUR 1343.20 EUR 514.40 EUR 928.80 EUR 352.00 EUR 3208.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P35908 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 15.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Keratin 2 expressed in: E.coli

Recombinant Keratin 2 (KRT2)
4-RPA491Mu01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q3TTY5 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 39.8kDa Isoelectric Point: 5.4
Description: Recombinant Mouse Keratin 2 expressed in: E.coli

Recombinant Keratin 2 (KRT2)
4-RPA491Ra01	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6IG02 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 21.1kDa Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 2 expressed in: E.coli

Recombinant Keratin 2 (KRT2)
4-RPA491Ra02	Cloud-Clone	EUR 440.48 EUR 221.00 EUR 1376.80 EUR 525.60 EUR 951.20 EUR 358.00 EUR 3292.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6IG02 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 17.5kDa Isoelectric Point: Inquire
Description: Recombinant Rat Keratin 2 expressed in: E.coli

Human Keratin 2 (KRT2) Protein
20-abx067618	Abbexa	EUR 606.00 EUR 258.00 EUR 1817.00 EUR 718.00 EUR 439.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Keratin 2 (KRT2) Protein
20-abx067619	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat Keratin 2 (KRT2) Protein
20-abx067620	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Keratin 2 (KRT2) Protein
20-abx167202	Abbexa	EUR 620.00 EUR 272.00 EUR 1859.00 EUR 732.00 EUR 453.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratin 2 (KRT2) Antibody (Biotin)
20-abx273325	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Keratin 2 (KRT2) Polyclonal Antibody (Human)
4-PAA491Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2)

Keratin 2 (KRT2) Polyclonal Antibody (Human), APC
4-PAA491Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Human), Biotinylated
4-PAA491Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Human), Cy3
4-PAA491Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Human), FITC
4-PAA491Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Human), HRP
4-PAA491Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Human), PE
4-PAA491Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with PE.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat)
4-PAA491Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2)

Keratin 2 (KRT2) Polyclonal Antibody (Mouse)
4-PAA491Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2)

Keratin 2 (KRT2) Polyclonal Antibody (Rat)
4-PAA491Ra02	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2)

Human KRT2/ Keratin, type II cytoskeletal 2 epidermal ELISA Kit
E1404Hu	Sunlong	1 Kit	EUR 571

Human KRT2(Keratin, type II cytoskeletal 2 epidermal) ELISA Kit
EH1589	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P35908 Alias: KRT2/Keratin, type II cytoskeletal 2 epiderma/Type-II keratin Kb2/Keratin-2e/K2e/Keratin-2 epidermis/Cytokeratin-2e/CK-2e/Epithelial keratin-2e/KRT2A/KRT2E/KRTE
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Keratin, type II cytoskeletal 2 epidermal, KRT2 ELISA KIT
ELI-04653h	Lifescience Market	96 Tests	EUR 824

Keratin 2 (KRT2) Polyclonal Antibody (Human), APC-Cy7
4-PAA491Hu01-APC-Cy7	Cloud-Clone	EUR 527.00 EUR 5818.00 EUR 1552.00 EUR 698.00 EUR 301.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Cys7~Leu160) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), APC
4-PAA491Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), Biotinylated
4-PAA491Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), Cy3
4-PAA491Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), FITC
4-PAA491Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), HRP
4-PAA491Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), PE
4-PAA491Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with PE.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), APC
4-PAA491Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA491Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), Cy3
4-PAA491Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), FITC
4-PAA491Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), HRP
4-PAA491Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), PE
4-PAA491Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with PE.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), APC
4-PAA491Ra02-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with APC.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), Biotinylated
4-PAA491Ra02-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with Biotin.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), Cy3
4-PAA491Ra02-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with Cy3.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), FITC
4-PAA491Ra02-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with FITC.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), HRP
4-PAA491Ra02-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with HRP.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), PE
4-PAA491Ra02-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with PE.

Mouse Keratin, type II cytoskeletal 2 epidermal, Krt2 ELISA KIT
ELI-04652m	Lifescience Market	96 Tests	EUR 865

Krt2/ Rat Krt2 ELISA Kit
ELI-04654r	Lifescience Market	96 Tests	EUR 886

Keratin 2 (KRT2) Polyclonal Antibody (Human, Rat), APC-Cy7
4-PAA491Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Glu508~Arg685) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Human, Rat Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx126071	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx327388	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx216486	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Keratin, Type II Cytoskeletal 2 Epidermal (KRT2) Antibody
20-abx211764	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Keratin 2 (KRT2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA491Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Arg200~Glu508) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Keratin 2 (KRT2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA491Ra02-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KRT2 (Ile368~Glu507) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Keratin 2 (KRT2). This antibody is labeled with APC-Cy7.

Human KRT2 ELISA Kit
ELA-E1427h	Lifescience Market	96 Tests	EUR 824

KRT2 ELISA KIT|Human
EF005745	Lifescience Market	96 Tests	EUR 689

Mouse KeMousein 2(KRT2)ELISA Kit
QY-E20878	Qayee Biotechnology	96T	EUR 361

KRT2 ELISA Kit (Human) (OKAN05492)
OKAN05492	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

KRT2 ELISA Kit (Human) (OKCD06389)
OKCD06389	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: KRT2A is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma.The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL

KRT2 ELISA Kit (Human) (OKEH01005)
OKEH01005	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Canine KRT2 ELISA KIT
ELI-04651d	Lifescience Market	96 Tests	EUR 928

KRT2 ELISA Kit (Mouse) (OKEH05503)
OKEH05503	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

KRT2 ELISA Kit (Rat) (OKEH06174)
OKEH06174	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Probably contributes to terminal cornification. Associated with keratinocyte activation, proliferation and keratinization.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

KRT2 siRNA
20-abx902902	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT2 siRNA
20-abx921979	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT2 siRNA
20-abx921980	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KRT2 Antibody
35627-100ul	SAB	100ul	EUR 252

KRT2 Antibody
1-CSB-PA005499	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against KRT2. Recognizes KRT2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/20000

KRT2 Antibody
1-CSB-PA443781	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against KRT2. Recognizes KRT2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

pMD19-KRT2
PVT17955	Lifescience Market	2 ug	EUR 231

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

KRT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1165203	ABM	1.0 ug DNA	EUR 154

Human Keratin- associated protein 2- 2, KRTAP2-2 ELISA KIT
ELI-21083h	Lifescience Market	96 Tests	EUR 824

Human KRT2 shRNA Plasmid
20-abx952610	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KRT2 Recombinant Protein (Human)
RP040489	ABM	100 ug	Ask for price

Human Keratin 9 ELISA Kit
ELA-E2283h	Lifescience Market	96 Tests	EUR 824

Human Keratin 8 ELISA Kit
ELA-E2287h	Lifescience Market	96 Tests	EUR 824

Human Keratin 16 ELISA Kit
ELA-E8852h	Lifescience Market	96 Tests	EUR 824

Human Keratin 15 ELISA Kit
ELA-E8853h	Lifescience Market	96 Tests	EUR 824

Human Keratin 12 ELISA Kit
ELA-E8860h	Lifescience Market	96 Tests	EUR 824

Human Keratin 19 ELISA Kit
ELA-E9126h	Lifescience Market	96 Tests	EUR 824

Human Keratin 20 ELISA Kit
ELA-E9127h	Lifescience Market	96 Tests	EUR 824

Human Keratin 13 ELISA Kit
ELA-E9417h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 10- 2, KRTAP10-2 ELISA KIT
ELI-12484h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 21- 2, KRTAP21-2 ELISA KIT
ELI-12489h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 22- 2, KRTAP22-2 ELISA KIT
ELI-12490h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 5- 2, KRTAP5-2 ELISA KIT
ELI-12492h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 6- 2, KRTAP6-2 ELISA KIT
ELI-12495h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 9- 2, KRTAP9-2 ELISA KIT
ELI-14434h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 4- 2, KRTAP4-2 ELISA KIT
ELI-21085h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 19- 2, KRTAP19-2 ELISA KIT
ELI-08758h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 20- 2, KRTAP20-2 ELISA KIT
ELI-08759h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 12- 2, KRTAP12-2 ELISA KIT
ELI-37261h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 3- 2, KRTAP3-2 ELISA KIT
ELI-37262h	Lifescience Market	96 Tests	EUR 824

Human Keratin- associated protein 13- 2, KRTAP13-2 ELISA KIT
ELI-43316h	Lifescience Market	96 Tests	EUR 824

KRT2 Conjugated Antibody
C35627	SAB	100ul	EUR 397

KRT2 cloning plasmid
CSB-CL012535HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1920 Sequence: ATGAGTTGTCAGATCTCTTGCAAATCTCGAGGAAGAGGAGGAGGTGGAGGAGGATTCCGGGGCTTCAGCAGCGGCTCAGCTGTGGTGTCTGGTGGAAGCCGGAGATCAACTTCCAGCTTCTCCTGCTTGAGCCGCCATGGTGGTGGTGGCGGGGGCTTCGGTGGAGGCGGCTTTG Show more
Description: A cloning plasmid for the KRT2 gene.

KRT2 Rabbit pAb
A10375-100ul	Abclonal	100 ul	EUR 308

KRT2 Rabbit pAb
A10375-200ul	Abclonal	200 ul	EUR 459

KRT2 Rabbit pAb
A10375-20ul	Abclonal	20 ul	EUR 183

KRT2 Rabbit pAb
A10375-50ul	Abclonal	50 ul	EUR 223

Anti-KRT2 antibody
STJ112411	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is expressed largely in the upper spinous layer of epidermal keratinocytes and mutations in this gene have been associated with bullous congenital ichthyosiform erythroderma. The type II cytokeratins are clustered in a region of chromosome 12q12-q13.

Human KRT2(Keratin 2) ELISA Kit