Human KERA(Keratocan) ELISA Kit
Human KERA(Keratocan) ELISA Kit
Human Keratocan (KERA) ELISA Kit |
RDR-KERA-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human KERA(Keratocan) ELISA Kit |
EH3283 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.313-20 ng/ml
- Uniprot ID: O60938
- Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml |
Human Keratocan (KERA) ELISA Kit |
20-abx152122 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Keratocan (KERA) ELISA Kit |
abx252686-96tests |
Abbexa |
96 tests |
EUR 707 |
- Shipped within 5-12 working days.
|
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
SEC553Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids. |
Human Keratocan (KERA) ELISA Kit |
4-SEC553Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2
- SLRR2B
- Keratocan Proteoglycan
- Keratan sulfate proteoglycan keratocan
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human Keratocan ELISA Kit (KERA) |
RK01722 |
Abclonal |
96 Tests |
EUR 521 |
Chicken Keratocan (KERA) ELISA Kit |
abx354671-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Monkey Keratocan (KERA) ELISA Kit |
abx354947-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Pig Keratocan (KERA) ELISA Kit |
abx355100-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Rabbit Keratocan (KERA) ELISA Kit |
abx355269-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Sheep Keratocan (KERA) ELISA Kit |
abx355357-96tests |
Abbexa |
96 tests |
EUR 926 |
- Shipped within 5-12 working days.
|
Mouse Keratocan (KERA) ELISA Kit |
abx389686-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Keratocan (KERA) Antibody |
20-abx129874 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratocan (KERA) Antibody |
20-abx104884 |
Abbexa |
-
EUR 481.00
-
EUR 133.00
-
EUR 1414.00
-
EUR 662.00
-
EUR 356.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Keratocan (KERA) Antibody |
abx026920-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Keratocan (KERA) Antibody |
abx026920-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Keratocan (KERA) Antibody |
20-abx173253 |
Abbexa |
|
|
|
Keratocan (KERA) Antibody |
20-abx177263 |
Abbexa |
|
|
|
Keratocan (KERA) Antibody |
20-abx321066 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Keratocan (KERA) |
4-RPC553Bo01 |
Cloud-Clone |
-
EUR 539.04
-
EUR 247.00
-
EUR 1746.40
-
EUR 648.80
-
EUR 1197.60
-
EUR 424.00
-
EUR 4216.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O62702
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.0kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Bovine Keratocan expressed in: E.coli |
Recombinant Keratocan (KERa) |
4-RPC553Mu01 |
Cloud-Clone |
-
EUR 485.28
-
EUR 233.00
-
EUR 1544.80
-
EUR 581.60
-
EUR 1063.20
-
EUR 388.00
-
EUR 3712.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: O35367
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 35.2kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Mouse Keratocan expressed in: E.coli |
ELISA kit for Human KERA (Keratocan) |
E-EL-H1794 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 534 |
- Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant |
ELISA kit for Human KERA (Keratocan) |
ELK3438 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA).
- Show more
|
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Human Keratocan (KERA) |
KTE61923-48T |
Abbkine |
48T |
EUR 332 |
- Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratocan (KERA) |
KTE61923-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratocan (KERA) |
KTE61923-96T |
Abbkine |
96T |
EUR 539 |
- Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Human Keratocan (KERA) CLIA Kit |
20-abx493762 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Human Keratocan (KERA) CLIA Kit |
abx197204-96tests |
Abbexa |
96 tests |
EUR 825 |
- Shipped within 5-12 working days.
|
Human Keratocan (KERA) Protein |
20-abx654110 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Cow Keratocan (KERA) Protein |
20-abx166318 |
Abbexa |
-
EUR 746.00
-
EUR 300.00
-
EUR 2346.00
-
EUR 899.00
-
EUR 537.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Mouse Keratocan (KERa) Protein |
20-abx167289 |
Abbexa |
-
EUR 676.00
-
EUR 286.00
-
EUR 2082.00
-
EUR 801.00
-
EUR 481.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
CLIA kit for Human KERA (Keratocan) |
E-CL-H1116 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 584 |
- Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the
- Show more
|
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant |
Keratocan (KERA) Polyclonal Antibody (Bovine) |
4-PAC553Bo01 |
Cloud-Clone |
-
EUR 276.00
-
EUR 2972.00
-
EUR 730.00
-
EUR 352.00
-
EUR 226.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA) |
Keratocan (KERA) Polyclonal Antibody (Bovine), APC |
4-PAC553Bo01-APC |
Cloud-Clone |
-
EUR 389.00
-
EUR 3905.00
-
EUR 1070.00
-
EUR 503.00
-
EUR 238.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC. |
Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated |
4-PAC553Bo01-Biotin |
Cloud-Clone |
-
EUR 344.00
-
EUR 2922.00
-
EUR 843.00
-
EUR 427.00
-
EUR 233.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin. |
Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3 |
4-PAC553Bo01-Cy3 |
Cloud-Clone |
-
EUR 477.00
-
EUR 5165.00
-
EUR 1385.00
-
EUR 629.00
-
EUR 276.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3. |
Keratocan (KERA) Polyclonal Antibody (Bovine), FITC |
4-PAC553Bo01-FITC |
Cloud-Clone |
-
EUR 331.00
-
EUR 3144.00
-
EUR 876.00
-
EUR 422.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC. |
Keratocan (KERA) Polyclonal Antibody (Bovine), HRP |
4-PAC553Bo01-HRP |
Cloud-Clone |
-
EUR 354.00
-
EUR 3401.00
-
EUR 944.00
-
EUR 452.00
-
EUR 223.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP. |
Keratocan (KERA) Polyclonal Antibody (Bovine), PE |
4-PAC553Bo01-PE |
Cloud-Clone |
-
EUR 331.00
-
EUR 3144.00
-
EUR 876.00
-
EUR 422.00
-
EUR 210.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat) |
4-PAC553Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA) |
Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7 |
4-PAC553Bo01-APC-Cy7 |
Cloud-Clone |
-
EUR 659.00
-
EUR 7690.00
-
EUR 2020.00
-
EUR 886.00
-
EUR 356.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERA (Arg21~Asn292)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC |
4-PAC553Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated |
4-PAC553Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3 |
4-PAC553Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC |
4-PAC553Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP |
4-PAC553Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE |
4-PAC553Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE. |
Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7 |
4-PAC553Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: KERa (Gln21~His292)
- Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
|
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7. |
KERA ELISA Kit (Human) (OKCD01682) |
OKCD01682 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL |
KERA siRNA |
20-abx921431 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KERA siRNA |
20-abx921432 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KERA Antibody |
1-CSB-PA012149ESR1HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Anti-Keratocan Antibody |
PB9653 |
BosterBio |
100ug/vial |
EUR 294 |
Human KERA shRNA Plasmid |
20-abx957578 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KERA Recombinant Protein (Human) |
RP016747 |
ABM |
100 ug |
Ask for price |
KERA cloning plasmid |
CSB-CL012149HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1059
- Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg
- Show more
|
Description: A cloning plasmid for the KERA gene. |
KERA ORF Vector (Human) (pORF) |
ORF005583 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Mouse KERA shRNA Plasmid |
20-abx971173 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KERA Recombinant Protein (Rat) |
RP207077 |
ABM |
100 ug |
Ask for price |
KERA Recombinant Protein (Mouse) |
RP145592 |
ABM |
100 ug |
Ask for price |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
KERA sgRNA CRISPR Lentivector set (Human) |
K1131001 |
ABM |
3 x 1.0 ug |
EUR 339 |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Polyclonal KERA Antibody (C-term) |
AMM06186G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KERA (C-term). This antibody is tested and proven to work in the following applications: |
Kera ORF Vector (Rat) (pORF) |
ORF069027 |
ABM |
1.0 ug DNA |
EUR 506 |
Kera ORF Vector (Mouse) (pORF) |
ORF048532 |
ABM |
1.0 ug DNA |
EUR 506 |
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
KERA sgRNA CRISPR Lentivector (Human) (Target 1) |
K1131002 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA sgRNA CRISPR Lentivector (Human) (Target 2) |
K1131003 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA sgRNA CRISPR Lentivector (Human) (Target 3) |
K1131004 |
ABM |
1.0 ug DNA |
EUR 154 |
KERA Protein Vector (Human) (pPB-C-His) |
PV022329 |
ABM |
500 ng |
EUR 329 |
KERA Protein Vector (Human) (pPB-N-His) |
PV022330 |
ABM |
500 ng |
EUR 329 |
KERA Protein Vector (Human) (pPM-C-HA) |
PV022331 |
ABM |
500 ng |
EUR 329 |
Human KERA(Keratocan) ELISA Kit