Human KERA(Keratocan) ELISA Kit

Human KERA(Keratocan) ELISA Kit

Human Keratocan (KERA) ELISA Kit
RD-KERA-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Keratocan (KERA) ELISA Kit
20-abx152122	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Keratocan (KERA) ELISA Kit
abx252686-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human KERA(Keratocan) ELISA Kit
EH3283	FN Test	96T	EUR 524.1
Detection range: 0.313-20 ng/ml Uniprot ID: O60938 Alias: KERA/Keratan sulfate proteoglycan keratocan/KTN/SLRR2B
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Keratocan, KERA ELISA KIT
ELI-47900h	Lifescience Market	96 Tests	EUR 824

Human Keratocan(KERA)ELISA Kit
QY-E02810	Qayee Biotechnology	96T	EUR 361

Human Keratocan ELISA Kit (KERA)
RK01722	Abclonal	96 Tests	EUR 521

Human Keratocan (KERA) ELISA Kit
SEC553Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
SEC553Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
SEC553Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratocan (KERA) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratocan (KERA) in tissue homogenates, cell lysates and other biological fluids.

Human Keratocan (KERA) ELISA Kit
4-SEC553Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Keratocan elisa. Alternative names of the recognized antigen: CNA2 SLRR2B Keratocan Proteoglycan Keratan sulfate proteoglycan keratocan
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratocan (KERA) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Chicken Keratocan, KERA ELISA KIT
ELI-15851c	Lifescience Market	96 Tests	EUR 928

Bovine Keratocan, KERA ELISA KIT
ELI-31165b	Lifescience Market	96 Tests	EUR 928

Mouse Keratocan, Kera ELISA KIT
ELI-44193m	Lifescience Market	96 Tests	EUR 865

Chicken Keratocan (KERA) ELISA Kit
abx354671-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Keratocan (KERA) ELISA Kit
abx354947-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Keratocan (KERA) ELISA Kit
abx355100-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Keratocan (KERA) ELISA Kit
abx355269-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Sheep Keratocan (KERA) ELISA Kit
abx355357-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Mouse Keratocan (KERA) ELISA Kit
abx389686-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Keratocan (KERA) Antibody
abx026920-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Keratocan (KERA) Antibody
abx026920-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Keratocan (KERA) Antibody
20-abx177263	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Keratocan (KERA) Antibody
20-abx104884	Abbexa	EUR 481.00 EUR 133.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratocan (KERA) Antibody
20-abx129874	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Keratocan (KERA) Antibody
20-abx173253	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Keratocan (KERA) Antibody
20-abx321066	Abbexa	EUR 439.00 EUR 328.00	100 ul 50 ul
Shipped within 5-10 working days.

Recombinant Keratocan (KERA)
4-RPC553Bo01	Cloud-Clone	EUR 539.04 EUR 247.00 EUR 1746.40 EUR 648.80 EUR 1197.60 EUR 424.00 EUR 4216.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O62702 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 35.0kDa Isoelectric Point: Inquire
Description: Recombinant Bovine Keratocan expressed in: E.coli

Recombinant Keratocan (KERa)
4-RPC553Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O35367 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 35.2kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Keratocan expressed in: E.coli

ELISA kit for Human KERA (Keratocan)
E-EL-H1794	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's KERA ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human KERA. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human KERA (Keratocan)
ELK3438	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratocan (KERA). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratocan (KERA). Show more
Description: A sandwich ELISA kit for detection of Keratocan from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Keratocan (KERA)
KTE61923-48T	Abbkine	48T	EUR 332
Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratocan (KERA)
KTE61923-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Keratocan (KERA)
KTE61923-96T	Abbkine	96T	EUR 539
Keratocan is a protein encoded by the KERA gene.Keratan sulfate proteoglycans (KSPGs) are members of the small leucine-rich proteoglycan (SLRP) family. KSPGs, particularly keratocan, lumican, and mimecan , are important to the transparency of the cor Show more
Description: Quantitative sandwich ELISA for measuring Human Keratocan (KERA) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Keratocan (KERA) CLIA Kit
abx197204-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Keratocan (KERA) CLIA Kit
20-abx493762	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Keratocan (KERA) Protein
20-abx654110	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Cow Keratocan (KERA) Protein
20-abx166318	Abbexa	EUR 746.00 EUR 300.00 EUR 2346.00 EUR 899.00 EUR 537.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Keratocan (KERa) Protein
20-abx167289	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

CLIA kit for Human KERA (Keratocan)
E-CL-H1116	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's KERA CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human KERA . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human KERA (Keratocan) in samples from Serum, Plasma, Cell supernatant

Keratocan (KERA) Polyclonal Antibody (Bovine)
4-PAC553Bo01	Cloud-Clone	EUR 276.00 EUR 2972.00 EUR 730.00 EUR 352.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA)

Keratocan (KERA) Polyclonal Antibody (Bovine), APC
4-PAC553Bo01-APC	Cloud-Clone	EUR 389.00 EUR 3905.00 EUR 1070.00 EUR 503.00 EUR 238.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC.

Keratocan (KERA) Polyclonal Antibody (Bovine), Biotinylated
4-PAC553Bo01-Biotin	Cloud-Clone	EUR 344.00 EUR 2922.00 EUR 843.00 EUR 427.00 EUR 233.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Biotin.

Keratocan (KERA) Polyclonal Antibody (Bovine), Cy3
4-PAC553Bo01-Cy3	Cloud-Clone	EUR 477.00 EUR 5165.00 EUR 1385.00 EUR 629.00 EUR 276.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with Cy3.

Keratocan (KERA) Polyclonal Antibody (Bovine), FITC
4-PAC553Bo01-FITC	Cloud-Clone	EUR 331.00 EUR 3144.00 EUR 876.00 EUR 422.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with FITC.

Keratocan (KERA) Polyclonal Antibody (Bovine), HRP
4-PAC553Bo01-HRP	Cloud-Clone	EUR 354.00 EUR 3401.00 EUR 944.00 EUR 452.00 EUR 223.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with HRP.

Keratocan (KERA) Polyclonal Antibody (Bovine), PE
4-PAC553Bo01-PE	Cloud-Clone	EUR 331.00 EUR 3144.00 EUR 876.00 EUR 422.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with PE.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat)
4-PAC553Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA)

Keratocan (KERA) Polyclonal Antibody (Bovine), APC-Cy7
4-PAC553Bo01-APC-Cy7	Cloud-Clone	EUR 659.00 EUR 7690.00 EUR 2020.00 EUR 886.00 EUR 356.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERA (Arg21~Asn292) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Bovine Keratocan (KERA). This antibody is labeled with APC-Cy7.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC
4-PAC553Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAC553Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Biotin.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAC553Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with Cy3.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), FITC
4-PAC553Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with FITC.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), HRP
4-PAC553Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with HRP.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), PE
4-PAC553Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with PE.

Keratocan (KERA) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAC553Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: KERa (Gln21~His292) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Keratocan (KERA). This antibody is labeled with APC-Cy7.

KERA ELISA KIT|Human
EF006946	Lifescience Market	96 Tests	EUR 689

KERA ELISA Kit (Human) (OKCD01682)
OKCD01682	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be important in developing and maintaining corneal transparency and for the structure of the stromal matrix. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.127 ng/mL

KERA Antibody
1-CSB-PA012149ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against KERA. Recognizes KERA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

KERA siRNA
20-abx921431	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

KERA siRNA
20-abx921432	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Anti-Keratocan Antibody
PB9653	BosterBio	100ug/vial	EUR 294

Human KERA shRNA Plasmid
20-abx957578	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KERA Recombinant Protein (Human)
RP016747	ABM	100 ug	Ask for price

KERA cloning plasmid
CSB-CL012149HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1059 Sequence: atggcaggcacaatctgtttcatcatgtgggtgttattcataacagacactgtgtggtctagaagtgtaaggcaggtctatgaagtacatgattcagatgattggactattcatgacttcgagtgtcccatggaatgtttctgcccacccagttttcctactgctttatattgtg Show more
Description: A cloning plasmid for the KERA gene.

KERA ORF Vector (Human) (pORF)
ORF005583	ABM	1.0 ug DNA	EUR 95

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse KERA shRNA Plasmid
20-abx971173	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

KERA Recombinant Protein (Rat)
RP207077	ABM	100 ug	Ask for price

KERA Recombinant Protein (Mouse)
RP145592	ABM	100 ug	Ask for price

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

KERA sgRNA CRISPR Lentivector set (Human)
K1131001	ABM	3 x 1.0 ug	EUR 339

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Polyclonal KERA Antibody (C-term)
AMM06186G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human KERA (C-term). This antibody is tested and proven to work in the following applications:

Kera ORF Vector (Rat) (pORF)
ORF069027	ABM	1.0 ug DNA	EUR 506

Kera ORF Vector (Mouse) (pORF)
ORF048532	ABM	1.0 ug DNA	EUR 506

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

KERA sgRNA CRISPR Lentivector (Human) (Target 1)
K1131002	ABM	1.0 ug DNA	EUR 154

KERA sgRNA CRISPR Lentivector (Human) (Target 2)
K1131003	ABM	1.0 ug DNA	EUR 154

KERA sgRNA CRISPR Lentivector (Human) (Target 3)
K1131004	ABM	1.0 ug DNA	EUR 154

KERA Protein Vector (Human) (pPB-C-His)
PV022329	ABM	500 ng	EUR 329

KERA Protein Vector (Human) (pPB-N-His)
PV022330	ABM	500 ng	EUR 329

KERA Protein Vector (Human) (pPM-C-HA)
PV022331	ABM	500 ng	EUR 329

Human KERA(Keratocan) ELISA Kit