Human JUP(Junction Plakoglobin) ELISA Kit
Human JUP(Junction Plakoglobin) ELISA Kit
Human Junction Plakoglobin (JUP) ELISA Kit |
RDR-JUP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Junction Plakoglobin (JUP) ELISA Kit |
RD-JUP-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Junction Plakoglobin (JUP) ELISA Kit |
RD-JUP-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Junction plakoglobin(JUP) ELISA kit |
E01J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Junction plakoglobin(JUP) ELISA kit |
E01J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Junction plakoglobin(JUP) ELISA kit |
E01J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Junction Plakoglobin (JUP) ELISA Kit |
20-abx152078 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human JUP/ Junction plakoglobin ELISA Kit |
E1363Hu |
Sunlong |
1 Kit |
EUR 605 |
Human JUP(Junction plakoglobin) ELISA Kit |
EH1772 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 0.156-10 ng/ml
- Uniprot ID: P14923
- Alias: JUP/Junction plakoglobin/Desmoplakin-3/Catenin gamma/Desmoplakin III
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml |
Human Junction Plakoglobin (JUP) ELISA Kit |
abx571094-96tests |
Abbexa |
96 tests |
EUR 739 |
- Shipped within 5-12 working days.
|
Human Junction Plakoglobin ELISA Kit (JUP) |
RK01719 |
Abclonal |
96 Tests |
EUR 521 |
Human Junction Plakoglobin (JUP) ELISA Kit |
SEC196Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Junction Plakoglobin (JUP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Junction Plakoglobin (JUP) in tissue homogenates, cell lysates and other biological fluids. |
Human Junction Plakoglobin (JUP) ELISA Kit |
SEC196Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Junction Plakoglobin (JUP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Junction Plakoglobin (JUP) in tissue homogenates, cell lysates and other biological fluids. |
Human Junction Plakoglobin (JUP) ELISA Kit |
SEC196Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Junction Plakoglobin (JUP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Junction Plakoglobin (JUP) in tissue homogenates, cell lysates and other biological fluids. |
Human Junction Plakoglobin (JUP) ELISA Kit |
SEC196Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Junction Plakoglobin (JUP) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Junction Plakoglobin (JUP) in tissue homogenates, cell lysates and other biological fluids. |
Human Junction Plakoglobin (JUP) ELISA Kit |
4-SEC196Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Junction Plakoglobin elisa. Alternative names of the recognized antigen: DP3
- gCat
- G-Cat
- CTNNG
- DPIII
- PDGB
- PKGB
- Gamma Catenin
- Desmoplakin III
- Desmoplakin-3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Junction Plakoglobin (JUP) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Junction Plakoglobin (JUP) Antibody |
abx025491-100ul |
Abbexa |
100 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx214494 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx214670 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx177234 |
Abbexa |
|
|
|
Junction Plakoglobin (JUP) Antibody |
20-abx113296 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx125028 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx173214 |
Abbexa |
|
|
|
Junction Plakoglobin (JUP) Antibody |
abx011985-100ul |
Abbexa |
100 ul |
EUR 411 |
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
abx034189-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
abx034189-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx241036 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx241037 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx329362 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
abx332410-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
abx332806-100ul |
Abbexa |
100 ul |
EUR 425 |
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx302765 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody |
20-abx000917 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Rat Junction plakoglobin(JUP) ELISA kit |
E02J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Junction plakoglobin(JUP) ELISA kit |
E02J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Junction plakoglobin(JUP) ELISA kit |
E02J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Junction plakoglobin(JUP) ELISA kit |
E04J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Junction plakoglobin(JUP) ELISA kit |
E04J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Junction plakoglobin(JUP) ELISA kit |
E04J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Junction plakoglobin(JUP) ELISA kit |
E03J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Junction plakoglobin(JUP) ELISA kit |
E03J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Junction plakoglobin(JUP) ELISA kit |
E03J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Junction plakoglobin(JUP) ELISA kit |
E09J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Junction plakoglobin(JUP) ELISA kit |
E09J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Junction plakoglobin(JUP) ELISA kit |
E09J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Junction plakoglobin(JUP) ELISA kit |
E06J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Junction plakoglobin(JUP) ELISA kit |
E06J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Junction plakoglobin(JUP) ELISA kit |
E06J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Junction plakoglobin(JUP) ELISA kit |
E08J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Junction plakoglobin(JUP) ELISA kit |
E08J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Junction plakoglobin(JUP) ELISA kit |
E08J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Junction plakoglobin(JUP) ELISA kit |
E07J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Junction plakoglobin(JUP) ELISA kit |
E07J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Junction plakoglobin(JUP) ELISA kit |
E07J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Junction Plakoglobin (JUP) ELISA Kit |
abx555670-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Cow Junction Plakoglobin (JUP) ELISA Kit |
abx555765-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Junction Plakoglobin (JUP) ELISA Kit |
abx556083-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Junction Plakoglobin (JUP) ELISA Kit |
abx556230-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Porcine Junction plakoglobin, Jup ELISA KIT |
ELI-37295p |
Lifescience Market |
96 Tests |
EUR 928 |
Human Junction Plakoglobin (JUP) Protein |
20-abx654091 |
Abbexa |
-
EUR 718.00
-
EUR 286.00
-
EUR 2221.00
-
EUR 857.00
-
EUR 509.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Junction Plakoglobin (JUP) CLIA Kit |
20-abx493532 |
Abbexa |
-
EUR 7911.00
-
EUR 4215.00
-
EUR 973.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
ELISA kit for Human JUP (Junction Plakoglobin) |
ELK3639 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Junction Plakoglobin (JUP). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Junctio
- Show more
|
Description: A sandwich ELISA kit for detection of Junction Plakoglobin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Junction Plakoglobin (JUP) Antibody (HRP) |
20-abx306545 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody (FITC) |
20-abx306546 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Junction Plakoglobin (JUP) Antibody (Biotin) |
20-abx306547 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Guinea pig Junction plakoglobin(JUP) ELISA kit |
E05J0005-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Junction plakoglobin(JUP) ELISA kit |
E05J0005-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Junction plakoglobin(JUP) ELISA kit |
E05J0005-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Junction plakoglobin(JUP) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Jup ELISA Kit| Rat Junction plakoglobin ELISA Kit |
EF018874 |
Lifescience Market |
96 Tests |
EUR 689 |
Jup ELISA Kit| Mouse Junction plakoglobin ELISA Kit |
EF015309 |
Lifescience Market |
96 Tests |
EUR 689 |
JUP ELISA Kit| Bovine Junction plakoglobin ELISA Kit |
EF011537 |
Lifescience Market |
96 Tests |
EUR 689 |
Polyclonal JUP/CTNNG/Junction Plakoglobin Antibody |
APR14348G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JUP/CTNNG/Junction Plakoglobin . This antibody is tested and proven to work in the following applications: |
Polyclonal JUP/CTNNG/Junction Plakoglobin Antibody (aa696-745) |
APR16959G |
Leading Biology |
0.05ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JUP/CTNNG/Junction Plakoglobin (aa696-745). This antibody is tested and proven to work in the following applications: |
Polyclonal JUP/CTNNG/Junction Plakoglobin Antibody (C-Terminus) |
APR16960G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JUP/CTNNG/Junction Plakoglobin (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal JUP/CTNNG/Junction Plakoglobin Antibody (C-Terminus) |
APR16961G |
Leading Biology |
0.1ml |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human JUP/CTNNG/Junction Plakoglobin (C-Terminus). This antibody is tested and proven to work in the following applications: |
Polyclonal JUP/CTNNG/Junction Plakoglobin Antibody (C-Terminus) |
APR16962G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human JUP/CTNNG/Junction Plakoglobin (C-Terminus). This antibody is tested and proven to work in the following applications: |
ELISA kit for Human Junction plakoglobin |
EK3658 |
SAB |
96 tests |
EUR 670 |
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Junction plakoglobin in samples from serum, plasma, tissue homogenates and other biological fluids. |
Monoclonal JUP/CTNNG/Junction Plakoglobin Antibody (clone 2G9), Clone: 2G9 |
APR16963G |
Leading Biology |
0.05mg |
EUR 528 |
Description: A Monoclonal antibody against Human JUP/CTNNG/Junction Plakoglobin (clone 2G9). The antibodies are raised in Mouse and are from clone 2G9. This antibody is applicable in WB and IHC-P, IF, E |
JUP ELISA Kit (Human) (OKAN04810) |
OKAN04810 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.056 ng/mL |
JUP ELISA Kit (Human) (OKCD08040) |
OKCD08040 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL |
JUP ELISA Kit (Human) (OKEH02508) |
OKEH02508 |
Aviva Systems Biology |
96 Wells |
EUR 779 |
Description: Description of target: This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.035 ng/mL |
Plakoglobin antibody |
10R-P128a |
Fitzgerald |
50 ug |
EUR 418 |
Description: Mouse monoclonal Plakoglobin antibody |
Plakoglobin Antibody |
abx430913-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
JUP ELISA Kit (Bovine) (OKEH08147) |
OKEH08147 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Bovine;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
JUP ELISA Kit (Pig) (OKEH08148) |
OKEH08148 |
Aviva Systems Biology |
96 Wells |
EUR 1092 |
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
JUP antibody |
70R-18051 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal JUP antibody |
JUP Antibody |
32095-100ul |
SAB |
100ul |
EUR 252 |
JUP Antibody |
1-CSB-PA843591 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100 |
JUP Antibody |
CSB-PA846873- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
JUP Antibody |
CSB-PA846873-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
- Show more
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100 |
JUP Antibody |
1-CSB-PA001293 |
Cusabio |
|
|
- Form: Liquid
- Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, IF, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.IF:1/200-1/1000.ELISA:1/20000 |
JUP Antibody |
1-CSB-PA12839A0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against JUP. Recognizes JUP from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200 |
JUP Antibody |
1-CSB-PA950440 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
JUP Antibody |
1-CSB-PA869662 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:200 |
JUP Antibody |
CSB-PA909861- |
Cusabio |
|
EUR 335 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
JUP Antibody |
CSB-PA909861-100ul |
Cusabio |
100ul |
EUR 316 |
- Form: liquid
- Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
- Show more
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000 |
JUP Antibody |
DF6147 |
Affbiotech |
200ul |
EUR 304 |
Description: JUP Antibody detects endogenous levels of total JUP. |
JUP Antibody |
1-CSB-PA044408 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100 |
JUP Antibody |
BF0590 |
Affbiotech |
200ul |
EUR 376 |
Description: JUP antibody detects endogenous levels of total JUP. |
JUP Antibody |
1-CSB-PA011975GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
Description: A polyclonal antibody against JUP. Recognizes JUP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
JUP siRNA |
20-abx902757 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
JUP siRNA |
20-abx921077 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
JUP siRNA |
20-abx921078 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Plakoglobin Antibody (Biotin) |
abx430914-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Human JUP shRNA Plasmid |
20-abx952509 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
JUP Recombinant Protein (Human) |
RP016522 |
ABM |
100 ug |
Ask for price |
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
JUP Rabbit pAb |
A0963-100ul |
Abclonal |
100 ul |
EUR 308 |
JUP Rabbit pAb |
A0963-200ul |
Abclonal |
200 ul |
EUR 459 |
JUP Rabbit pAb |
A0963-20ul |
Abclonal |
20 ul |
EUR 183 |
JUP Rabbit pAb |
A0963-50ul |
Abclonal |
50 ul |
EUR 223 |
JUP Blocking Peptide |
DF6147-BP |
Affbiotech |
1mg |
EUR 195 |
JUP Conjugated Antibody |
C32095 |
SAB |
100ul |
EUR 397 |
JUP Blocking Peptide |
BF0590-BP |
Affbiotech |
1mg |
EUR 195 |
JUP cloning plasmid |
CSB-CL011975HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 2238
- Sequence: atggaggtgatgaacctgatggagcagcctatcaaggtgactgagtggcagcagacatacacctacgactcgggtatccactcgggcgccaacacctgcgtgccctccgtcagcagcaagggcatcatggaggaggatgaggcctgcgggcgccagtacacgctcaagaaaacca
- Show more
|
Description: A cloning plasmid for the JUP gene. |
JUP Polyclonal Antibody |
A50692 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
anti-JUP (4C12) |
LF-MA30633 |
Abfrontier |
100 ul |
EUR 527 |
Description: Mouse Monoclonal to JUP |
Anti-JUP antibody |
STJ24277 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. |
JUP ORF Vector (Human) (pORF) |
ORF005508 |
ABM |
1.0 ug DNA |
EUR 95 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Human Tight Junction Protein 1 ELISA kit |
E01T0219-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Tight Junction Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tight Junction Protein 1 ELISA kit |
E01T0219-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Tight Junction Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tight Junction Protein 1 ELISA kit |
E01T0219-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Tight Junction Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
JUP Antibody, HRP conjugated |
1-CSB-PA12839B0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against JUP. Recognizes JUP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
JUP Antibody, FITC conjugated |
1-CSB-PA12839C0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against JUP. Recognizes JUP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
JUP Antibody, Biotin conjugated |
1-CSB-PA12839D0Rb |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against JUP. Recognizes JUP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Rat JUP shRNA Plasmid |
20-abx986649 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Mouse JUP shRNA Plasmid |
20-abx971129 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
JUP Recombinant Protein (Rat) |
RP206582 |
ABM |
100 ug |
Ask for price |
JUP Recombinant Protein (Mouse) |
RP144791 |
ABM |
100 ug |
Ask for price |
Human Tight Junction Protein 1 (TJP1) ELISA Kit |
DLR-TJP1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Tight Junction Protein 1 (TJP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tight Junction Protein 1 (TJP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Tight Junction Protein 1 (TJP1) ELISA Kit |
DLR-TJP1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Tight Junction Protein 1 (TJP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tight Junction Protein 1 (TJP1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Tight Junction Protein 2 (TJP2) ELISA Kit |
DLR-TJP2-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Tight Junction Protein 2 (TJP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tight Junction Protein 2 (TJP2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Tight Junction Protein 2 (TJP2) ELISA Kit |
DLR-TJP2-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Tight Junction Protein 2 (TJP2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Tight Junction Protein 2 (TJP2) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Gap Junction protein,Alpha 5,40kd ELISA kit |
E01G0028-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Gap Junction protein,Alpha 5,40kd in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gap Junction protein,Alpha 5,40kd ELISA kit |
E01G0028-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Gap Junction protein,Alpha 5,40kd in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gap Junction protein,Alpha 5,40kd ELISA kit |
E01G0028-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Gap Junction protein,Alpha 5,40kd in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gap Junction Protein β 1 ELISA kit |
E01G0181-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gap Junction Protein β 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gap Junction Protein β 1 ELISA kit |
E01G0181-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gap Junction Protein β 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Gap Junction Protein β 1 ELISA kit |
E01G0181-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Gap Junction Protein β 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crossover junction endonuclease EME1(EME1) ELISA kit |
E01C2284-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crossover junction endonuclease EME1(EME1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crossover junction endonuclease EME1(EME1) ELISA kit |
E01C2284-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crossover junction endonuclease EME1(EME1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crossover junction endonuclease EME1(EME1) ELISA kit |
E01C2284-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crossover junction endonuclease EME1(EME1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crossover junction endonuclease MUS81(MUS81) ELISA kit |
E01C2349-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crossover junction endonuclease MUS81(MUS81) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crossover junction endonuclease MUS81(MUS81) ELISA kit |
E01C2349-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crossover junction endonuclease MUS81(MUS81) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Crossover junction endonuclease MUS81(MUS81) ELISA kit |
E01C2349-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Crossover junction endonuclease MUS81(MUS81) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tight Junction Protein 1 (TJP1) ELISA Kit |
20-abx153309 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human JUP(Junction Plakoglobin) ELISA Kit