Human GML(Glycosylphosphatidylinositol Anchored Molecule Like Protein) ELISA Kit

Human GML(Glycosylphosphatidylinositol Anchored Molecule Like Protein) ELISA Kit

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RDR-GML-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RD-GML-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
RD-GML-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Antibody
20-abx129231	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Antibody
20-abx172648	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)
4-RPG832Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q99445 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.7kDa Isoelectric Point: Inquire
Description: Recombinant Human Glycosylphosphatidylinositol Anchored Molecule Like Protein expressed in: E.coli

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)ELISA Kit
201-12-2723	SunredBio	96 tests	EUR 440
This Glycosylphosphatidylinositol Anchored Molecule Like Protein ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
20-abx151698	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
abx570812-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein(GML)ELISA Kit
QY-E04903	Qayee Biotechnology	96T	EUR 361

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
SEG832Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intr Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in Tissue homogenates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) ELISA Kit
4-SEG832Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glycosylphosphatidylinositol Anchored Molecule Like Protein elisa. Alternative names of the recognized antigen: LY6DL GPI Anchored Molecule Like Protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Protein
20-abx167978	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) CLIA Kit
20-abx495310	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human GML (Glycosylphosphatidylinositol Anchored Molecule Like Protein)
ELK3290	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). Standards or samples are then added to the appropriate microtiter plate wells with a biotin- Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Anchored Molecule Like Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human)
4-PAG832Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML)

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), APC
4-PAG832Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with APC.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), Biotinylated
4-PAG832Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with Biotin.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), Cy3
4-PAG832Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with Cy3.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), FITC
4-PAG832Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with FITC.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), HRP
4-PAG832Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with HRP.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), PE
4-PAG832Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with PE.

Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML) Polyclonal Antibody (Human), APC-Cy7
4-PAG832Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GML (Met21~Pro158) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Glycosylphosphatidylinositol Anchored Molecule Like Protein (GML). This antibody is labeled with APC-Cy7.

Gpihbp1 ELISA Kit| Mouse Glycosylphosphatidylinositol-anchored
EF015079	Lifescience Market	96 Tests	EUR 689

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
DLR-GPIHBP1-Hu-48T	DL Develop	48T	EUR 554
Should the Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
DLR-GPIHBP1-Hu-96T	DL Develop	96T	EUR 725
Should the Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
20-abx151714	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1(GPIHBP1)ELISA Kit
QY-E03408	Qayee Biotechnology	96T	EUR 361

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
RDR-GPIHBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
RDR-GPIHBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
RD-GPIHBP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
RD-GPIHBP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
SEM435Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
SEM435Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
SEM435Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
SEM435Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) were tested on 3 different plates, 8 replicates in each plate Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in tissue homogenates, cell lysates and other biological fluids.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
4-SEM435Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 elisa. Alternative names of the recognized antigen: GPI-HBP1 High density lipoprotein-binding protein 1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human GPIHBP1 (Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1)
ELK6567	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1). Standards or samples are then added to the appropriate microtiter p Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) ELISA Kit
abx389446-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) Protein
20-abx653613	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) CLIA Kit
20-abx496059	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) Antibody
20-abx176679	Abbexa	EUR 1316.00 EUR 620.00	1 mg 200 ug
Please enquire.

Glycosylphosphatidylinositol Anchored High Density Lipoprotein Binding Protein 1 (GPIHBP1) Antibody
20-abx172647	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody
20-abx318775	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Human GML ELISA KIT
ELI-31790h	Lifescience Market	96 Tests	EUR 824

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody (HRP)
20-abx317490	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody (FITC)
20-abx317491	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Glycosylphosphatidylinositol-Anchored High Density Lipoprotein-Binding Protein 1 (GPIHBP1) Antibody (Biotin)
20-abx317492	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GML ELISA Kit (Human) (OKCD00518)
OKCD00518	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May play a role in the apoptotic pathway or cell-cycle regulation induced by p53/TP53 after DNA damage. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

GML ELISA Kit (Human) (OKDD00286)
OKDD00286	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

GML Recombinant Protein (Human)
RP039502	ABM	100 ug	Ask for price

Human Resistin like molecule β ELISA kit
E01R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resistin like molecule β ELISA kit
E01R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Resistin like molecule β ELISA kit
E01R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GML siRNA
20-abx918117	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-GML
YF-PA23786	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to GML

CD5 Molecule-Like Protein
20-abx262648	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

GML Recombinant Protein (Mouse)
RP138860	ABM	100 ug	Ask for price

Human GML shRNA Plasmid
20-abx951836	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit
abx387626-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human CD300LB/ CMRF35-like molecule 7 ELISA Kit
E0416Hu	Sunlong	1 Kit	EUR 605

Human CMRF35 like molecule 8(CD300A) ELISA kit
E01C1477-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 8(CD300A) ELISA kit
E01C1477-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 8(CD300A) ELISA kit
E01C1477-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 6(CD300C) ELISA kit
E01C1478-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 6(CD300C) ELISA kit
E01C1478-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 6(CD300C) ELISA kit
E01C1478-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit
E01C1479-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit
E01C1479-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 2(CD300E) ELISA kit
E01C1479-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 7(CD300LB) ELISA kit
E01C1480-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 7(CD300LB) ELISA kit
E01C1480-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 7(CD300LB) ELISA kit
E01C1480-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 4(CD300LD) ELISA kit
E01C1481-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 4(CD300LD) ELISA kit
E01C1481-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 4(CD300LD) ELISA kit
E01C1481-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 1(CD300LF) ELISA kit
E01C1482-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 1(CD300LF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 1(CD300LF) ELISA kit
E01C1482-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 1(CD300LF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 1(CD300LF) ELISA kit
E01C1482-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 1(CD300LF) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 9(CD300LG) ELISA kit
E01C1483-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 9(CD300LG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 9(CD300LG) ELISA kit
E01C1483-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 9(CD300LG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CMRF35 like molecule 9(CD300LG) ELISA kit
E01C1483-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human CMRF35 like molecule 9(CD300LG) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human CMRF35-like molecule 7
EK3115	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human CMRF35-like molecule 7 in samples from serum, plasma, tissue homogenates and other biological fluids.

Human CD300LB(CMRF35-like molecule 7) ELISA Kit
EH1453	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: A8K4G0 Alias: CD300LB/CMRF35-like molecule 7/CLM-7/Triggering receptor expressed on myeloid cells 5/TREM-5/Leukocyte mono-Ig-like receptor 5/Immune receptor expressed on myeloid cells 3/IREM-3/CD300 antigen- Show more
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

Human CMRF35- like molecule 2, CD300E ELISA KIT
ELI-10372h	Lifescience Market	96 Tests	EUR 824

Human CMRF35- like molecule 9, CD300LG ELISA KIT
ELI-10607h	Lifescience Market	96 Tests	EUR 824

Human Junctional adhesion molecule- like, AMICA1 ELISA KIT
ELI-19682h	Lifescience Market	96 Tests	EUR 824

Human CMRF35- like molecule 8, CD300A ELISA KIT
ELI-25610h	Lifescience Market	96 Tests	EUR 824

Human CMRF35- like molecule 4, CD300LD ELISA KIT
ELI-25814h	Lifescience Market	96 Tests	EUR 824

Human CMRF35- like molecule 6, CD300C ELISA KIT
ELI-26336h	Lifescience Market	96 Tests	EUR 824

Human CMRF35- like molecule 1, CD300LF ELISA KIT
ELI-46811h	Lifescience Market	96 Tests	EUR 824

Human CMRF35-like molecule 7(CD300LB) ELISA kit
CSB-EL004919HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CMRF35-like molecule 7 (CD300LB) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human CMRF35-like molecule 7(CD300LB) ELISA kit
1-CSB-EL004919HU	Cusabio	EUR 703.00 EUR 4843.00 EUR 2570.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human CMRF35-like molecule 7(CD300LB) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Junction Adhesion Molecule Like (JAML) ELISA Kit
abx388054-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human CMRF35- like molecule 7, CD300LB ELISA KIT
ELI-50988h	Lifescience Market	96 Tests	EUR 824

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

GML cloning plasmid
CSB-CL860340HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 477 Sequence: atgctcctctttgccttactcctagccatggagctcccattggtggcagccagtgccaccatgcgcgctcagtggacttacagtttgagatgccatgactgtgcggtcataaatgacttcaactgtcccaacattagagtatgtccgtatcatattaggcgctgtatgacaatctc Show more
Description: A cloning plasmid for the GML gene.

Anti-GML (5F4)
YF-MA13268	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GML

Anti-GML (1E7)
YF-MA13269	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GML

Rabbit Resistin like molecule β ELISA kit
E04R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Resistin like molecule β ELISA kit
E04R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Resistin like molecule β ELISA kit
E04R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Resistin like molecule β ELISA kit
E02R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Resistin like molecule β ELISA kit
E02R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Resistin like molecule β ELISA kit
E02R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Resistin like molecule β ELISA kit
E03R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Resistin like molecule β ELISA kit
E03R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Resistin like molecule β ELISA kit
E03R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Resistin like molecule β ELISA kit
E06R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Resistin like molecule β ELISA kit
E06R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Resistin like molecule β ELISA kit
E06R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Resistin like molecule β ELISA kit
E08R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Resistin like molecule β ELISA kit
E08R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Resistin like molecule β ELISA kit
E08R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Resistin like molecule β ELISA kit
E09R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Resistin like molecule β ELISA kit
E09R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Resistin like molecule β ELISA kit
E09R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Resistin like molecule β ELISA kit
E07R0343-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Resistin like molecule β ELISA kit
E07R0343-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Resistin like molecule β ELISA kit
E07R0343-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Resistin like molecule β in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse CMRF35- like molecule, Clm ELISA KIT
ELI-25927m	Lifescience Market	96 Tests	EUR 865

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
DLR-GPLD1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
DLR-GPLD1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from serum, plasma or other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
20-abx151715	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
abx250820-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 ELISA Kit (GPLD1)
RK01496	Abclonal	96 Tests	EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RDR-GPLD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RD-GPLD1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
RD-GPLD1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
SEH975Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-A Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in serum, plasma and other biological fluids.

Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) ELISA Kit
4-SEH975Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Glycosylphosphatidylinositol Specific Phospholipase D1 elisa. Alternative names of the recognized antigen: GPIPLD GPIPLDM PIGPLD PIGPLD1 Glycoprotein phospholipase D Glycosyl-phosphatidylinositol-specific phospholipase D
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

CD5 Molecule-Like, HEK Protein
20-abx262785	Abbexa	EUR 328.00 EUR 6397.00 EUR 230.00	10 ug 1 mg 2 µg
Shipped within 5-10 working days.

Human Resistin-like Molecule β (RELM-β) ELISA Kit
CSB-E13852h-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Resistin-like Molecule β (RELM-β) in samples from serum, plasma, cell culture supernates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Resistin-like Molecule β (RELM-β) ELISA Kit
1-CSB-E13852h	Cusabio	EUR 900.00 EUR 5476.00 EUR 2900.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Resistin-like Molecule β (RELM-β) in samples from serum, plasma, cell culture supernates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human CMRF35-Like Molecule 1 / IREM1 (CD300LF) ELISA Kit
abx386392-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human CMRF35-Like Molecule 9 / TREM4 (CD300LG) ELISA Kit
abx386393-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

GML ORF Vector (Human) (pORF)
ORF013168	ABM	1.0 ug DNA	EUR 354

Human Neural cell adhesion molecule L1-like protein(CHL1) ELISA kit
CSB-EL005355HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neural cell adhesion molecule L1-like protein (CHL1) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neural cell adhesion molecule L1-like protein(CHL1) ELISA kit
1-CSB-EL005355HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neural cell adhesion molecule L1-like protein(CHL1) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

CD5L CD5 Molecule-Like Human Recombinant Protein
PROTO43866	BosterBio	Regular: 10ug	EUR 317
Description: CD5L Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (a.a 20-347) containing 337 amino acids including a 9 a.a N-terminal His tag. The total molecular mass is 37.2kDa (calculated).

Gpaa1 ELISA Kit| Mouse Glycosylphosphatidylinositol anchor atta
EF015090	Lifescience Market	96 Tests	EUR 689

GML Protein Vector (Human) (pPB-C-His)
PV052669	ABM	500 ng	EUR 481

GML Protein Vector (Human) (pPB-N-His)
PV052670	ABM	500 ng	EUR 481

GML Protein Vector (Human) (pPM-C-HA)
PV052671	ABM	500 ng	EUR 481

GML Protein Vector (Human) (pPM-C-His)
PV052672	ABM	500 ng	EUR 481

Mouse Glycosylphosphatidylinositol Anchor Attachment 1 Protein (GPAA1) ELISA Kit
abx389456-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)
E-EL-H0397	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's GPLD1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human GPLD1. Standards or samples are added to the micro ELISA plate wells and combined with Show more
Description: A sandwich ELISA kit for quantitative measurement of Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human GPLD1 (Glycosylphosphatidylinositol Specific Phospholipase D1)
ELK3447	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Glycosylphosphatidylinositol Specific Phospholipase D1 (GPLD1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-con Show more
Description: A sandwich ELISA kit for detection of Glycosylphosphatidylinositol Specific Phospholipase D1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat CMRF35 like molecule 8(CD300A) ELISA kit
E02C1477-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 8(CD300A) ELISA kit
E02C1477-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 8(CD300A) ELISA kit
E02C1477-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 8(CD300A) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 6(CD300C) ELISA kit
E02C1478-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 6(CD300C) ELISA kit
E02C1478-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 6(CD300C) ELISA kit
E02C1478-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 6(CD300C) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit
E02C1479-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit
E02C1479-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 2(CD300E) ELISA kit
E02C1479-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 2(CD300E) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 7(CD300LB) ELISA kit
E02C1480-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 7(CD300LB) ELISA kit
E02C1480-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 7(CD300LB) ELISA kit
E02C1480-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 7(CD300LB) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 4(CD300LD) ELISA kit
E02C1481-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 4(CD300LD) ELISA kit
E02C1481-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat CMRF35 like molecule 4(CD300LD) ELISA kit
E02C1481-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat CMRF35 like molecule 4(CD300LD) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human GML(Glycosylphosphatidylinositol Anchored Molecule Like Protein) ELISA Kit