Human GAN(Gigaxonin) ELISA Kit

Human GAN(Gigaxonin) ELISA Kit

Human Gigaxonin (GAN) ELISA Kit

RD-GAN-Hu-96Tests 96 Tests
EUR 723

Human Gigaxonin (GAN) ELISA Kit

RDR-GAN-Hu-48Tests 48 Tests
EUR 544

Human Gigaxonin (GAN) ELISA Kit

RDR-GAN-Hu-96Tests 96 Tests
EUR 756

Human Gigaxonin, GAN ELISA KIT

ELI-32458h 96 Tests
EUR 824

Human Gigaxonin (GAN) ELISA Kit

20-abx151662
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Gigaxonin (GAN)ELISA Kit

201-12-2714 96 tests
EUR 440
  • This Gigaxonin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Gigaxonin(GAN)ELISA Kit

QY-E04908 96T
EUR 361

Human Gigaxonin (GAN) ELISA Kit

SEJ068Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit

SEJ068Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit

SEJ068Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit

SEJ068Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Gigaxonin (GAN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Gigaxonin (GAN) in Tissue homogenates and other biological fluids.

Human Gigaxonin (GAN) ELISA Kit

4-SEJ068Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Gigaxonin elisa. Alternative names of the recognized antigen: GAN1
  • KLHL16
  • Giant Axonal Neuropathy
  • Kelch-like protein 16
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Gigaxonin (GAN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Gigaxonin (GAN) Antibody

20-abx112713
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody

20-abx128377
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Gigaxonin (GAN) Antibody

20-abx003113
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody

abx145835-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody

20-abx172539
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Gigaxonin (GAN) Antibody

20-abx320505
  • EUR 300.00
  • EUR 244.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Gigaxonin (GAN) Antibody

abx233339-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Gigaxonin (GAN)

4-RPJ068Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9H2C0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 37.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Gigaxonin expressed in: E.coli

Mouse Gigaxonin, Gan ELISA KIT

ELI-48392m 96 Tests
EUR 865

Mouse Gigaxonin (GAN) ELISA Kit

abx389398-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Gigaxonin (GAN) Protein

20-abx166536
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Human GAN (Gigaxonin)

ELK3607 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Gigaxonin (GAN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Gigaxonin (GAN). N
  • Show more
Description: A sandwich ELISA kit for detection of Gigaxonin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Gigaxonin (GAN) CLIA Kit

20-abx495603
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Gan ELISA Kit| Mouse Gigaxonin ELISA Kit

EF015031 96 Tests
EUR 689

Gigaxonin (GAN) Polyclonal Antibody (Human)

4-PAJ068Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN)

Gigaxonin (GAN) Polyclonal Antibody (Human), APC

4-PAJ068Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with APC.

Gigaxonin (GAN) Polyclonal Antibody (Human), Biotinylated

4-PAJ068Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with Biotin.

Gigaxonin (GAN) Polyclonal Antibody (Human), Cy3

4-PAJ068Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with Cy3.

Gigaxonin (GAN) Polyclonal Antibody (Human), FITC

4-PAJ068Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with FITC.

Gigaxonin (GAN) Polyclonal Antibody (Human), HRP

4-PAJ068Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with HRP.

Gigaxonin (GAN) Polyclonal Antibody (Human), PE

4-PAJ068Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with PE.

Gigaxonin (GAN) Polyclonal Antibody (Human), APC-Cy7

4-PAJ068Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: GAN (Cys30~Gly326)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Gigaxonin (GAN). This antibody is labeled with APC-Cy7.

GAN ELISA KIT|Human

EF009777 96 Tests
EUR 689

GAN ELISA Kit (Human) (OKCD00554)

OKCD00554 96 Wells
EUR 831
Description: Description of target: Probable cytoskeletal component that directly or indirectly plays an important role in neurofilament architecture. May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Controls degradation of TBCB. Controls degradation of MAP1B and MAP1S, and is critical for neuronal maintenance and survival.4 Publications <p>Manually curated information for which there is published experimental evidence.</p> <p><a href="/manual/evidences#ECO:0000269">More…</a></p> Manual assertion based on experiment iniRef.3"Microtubule-associated protein 1B: a neuronal binding partner for gigaxonin."_x005F_x005F_x000D_Ding J., Liu J.-J., Kowal A.S., Nardine T., Bhattacharya P., Lee A., Yang Y._x005F_x005F_x000D_J. Cell Biol. 158:427-433(2002) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH MAP1B, SUBCELLULAR LOCATION, TISSUE SPECIFICITY.Ref.5"Gigaxonin interacts with tubulin folding cofactor B and controls its degradation through the ubiquitin-proteasome pathway."_x005F_x005F_x000D_Wang W., Ding J., Allen E., Zhu P., Zhang L., Vogel H., Yang Y._x005F_x005F_x000D_Curr. Biol. 15:2050-2055(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH TBCB, CHARACTERIZATION OF VARIANTS GAN1 SER-15; PHE-82 AND CYS-545.Ref.6"Ubiquitination of Keap1, a BTB-Kelch substrate adaptor protein for Cul3, targets Keap1 for degradation by a proteasome-independent pathway."_x005F_x005F_x000D_Zhang D.D., Lo S.C., Sun Z., Habib G.M., Lieberman M.W., Hannink M._x005F_x005F_x000D_J. Biol. Chem. 280:30091-30099(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, IDENTIFICATION IN A COMPLEX WITH CUL3 AND RBX1, UBIQUITINATION.Ref.7"Gigaxonin-controlled degradation of MAP1B light chain is critical to neuronal survival."_x005F_x005F_x000D_Allen E., Ding J., Wang W., Pramanik S., Chou J., Yau V., Yang Y._x005F_x005F_x000D_Nature 438:224-228(2005) [PubMed] [Europe PMC] [Abstract]Cited for: FUNCTION, INTERACTION WITH UBA1 AND MAP1B. <p>Describes the metabolic pathway(s) associated with a protein.</p><p><a href='../manual/pathway' target='_top'>More...</a></p>Pathwayi: protein ubiquitinationThis protein is involved in the pathway protein ubiquitination, which is part of Protein modification._x005F_x005F_x000D_View all proteins of this organism that are known to be involved in the pathway protein ubiquitination and in Protein modification. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

GAN ELISA Kit (Human) (OKDD00281)

OKDD00281 96 Wells
EUR 975
Description: Description of target: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN).;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

anti-Gigaxonin

YF-PA25049 50 ul
EUR 334
Description: Mouse polyclonal to Gigaxonin

Anti-Gigaxonin (4G7)

YF-MA16298 100 ug
EUR 363
Description: Mouse monoclonal to Gigaxonin

GAN siRNA

20-abx917571
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAN siRNA

20-abx917572
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

GAN antibody

70R-4075 50 ug
EUR 467
Description: Rabbit polyclonal GAN antibody raised against the middle region of GAN

GAN antibody

43479-100ul 100ul
EUR 252

GAN antibody

43479-50ul 50ul
EUR 187

GAN antibody

70R-17420 50 ul
EUR 435
Description: Rabbit polyclonal GAN antibody

GAN Antibody

1-CSB-PA009228ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against GAN. Recognizes GAN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

GAN Antibody

1-CSB-PA009228GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against GAN. Recognizes GAN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human GAN shRNA Plasmid

20-abx955378
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GAN Recombinant Protein (Human)

RP012904 100 ug Ask for price

GAN cloning plasmid

CSB-CL009228HU-10ug 10ug
EUR 612
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1794
  • Sequence: atggctgagggcagtgccgtgtctgaccctcagcacgccgcgcgtctgctgcgagcgctcagctctttccgcgaggagtctcgcttctgcgacgcgcacctggtcctcgacggggaggagatcccggtgcagaagaacatcctggcggcggccagcccgtacatcaggacaaagt
  • Show more
Description: A cloning plasmid for the GAN gene.

anti- GAN antibody

FNab03339 100µg
EUR 548.75
  • Immunogen: gigaxonin
  • Uniprot ID: Q9H2C0
  • Research Area: Neuroscience, Metabolism
Description: Antibody raised against GAN

GAN Rabbit pAb

A4205-100ul 100 ul
EUR 308

GAN Rabbit pAb

A4205-200ul 200 ul
EUR 459

GAN Rabbit pAb

A4205-20ul 20 ul
EUR 183

GAN Rabbit pAb

A4205-50ul 50 ul
EUR 223

GAN Blocking Peptide

33R-4223 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GAN antibody, catalog no. 70R-4075

GAN Polyclonal Antibody

30534-100ul 100ul
EUR 252

GAN Polyclonal Antibody

30534-50ul 50ul
EUR 187

Anti-GAN antibody

PAab03339 100 ug
EUR 386

Anti-GAN antibody

STJ23745 100 µl
EUR 277
Description: This gene encodes a member of the cytoskeletal BTB/kelch (Broad-Complex, Tramtrack and Bric a brac) repeat family. The encoded protein plays a role in neurofilament architecture and is involved in mediating the ubiquitination and degradation of some proteins. Defects in this gene are a cause of giant axonal neuropathy (GAN).

GAN ORF Vector (Human) (pORF)

ORF004302 1.0 ug DNA
EUR 95

GAN Polyclonal Conjugated Antibody

C43479 100ul
EUR 397

GAN Polyclonal Conjugated Antibody

C30534 100ul
EUR 397

Mouse GAN shRNA Plasmid

20-abx980604
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

GAN Recombinant Protein (Rat)

RP202226 100 ug Ask for price

GAN Recombinant Protein (Mouse)

RP135896 100 ug Ask for price

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

GAN sgRNA CRISPR Lentivector set (Human)

K0837701 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Gan ORF Vector (Rat) (pORF)

ORF067410 1.0 ug DNA
EUR 506

Gan ORF Vector (Mouse) (pORF)

ORF045300 1.0 ug DNA
EUR 506

GAN sgRNA CRISPR Lentivector (Human) (Target 1)

K0837702 1.0 ug DNA
EUR 154

GAN sgRNA CRISPR Lentivector (Human) (Target 2)

K0837703 1.0 ug DNA
EUR 154

GAN sgRNA CRISPR Lentivector (Human) (Target 3)

K0837704 1.0 ug DNA
EUR 154

GAN Protein Vector (Human) (pPB-C-His)

PV017205 500 ng
EUR 329

GAN Protein Vector (Human) (pPB-N-His)

PV017206 500 ng
EUR 329

GAN Protein Vector (Human) (pPM-C-HA)

PV017207 500 ng
EUR 329

GAN Protein Vector (Human) (pPM-C-His)

PV017208 500 ng
EUR 329

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Gan sgRNA CRISPR Lentivector set (Mouse)

K3108001 3 x 1.0 ug
EUR 339

Gan sgRNA CRISPR Lentivector set (Rat)

K6058501 3 x 1.0 ug
EUR 339

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

Gan sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3108002 1.0 ug DNA
EUR 154

Gan sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3108003 1.0 ug DNA
EUR 154

Gan sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3108004 1.0 ug DNA
EUR 154

Gan sgRNA CRISPR Lentivector (Rat) (Target 1)

K6058502 1.0 ug DNA
EUR 154

Gan sgRNA CRISPR Lentivector (Rat) (Target 2)

K6058503 1.0 ug DNA
EUR 154

Gan sgRNA CRISPR Lentivector (Rat) (Target 3)

K6058504 1.0 ug DNA
EUR 154

GAN Protein Vector (Rat) (pPB-C-His)

PV269638 500 ng
EUR 603

GAN Protein Vector (Rat) (pPB-N-His)

PV269639 500 ng
EUR 603

GAN Protein Vector (Rat) (pPM-C-HA)

PV269640 500 ng
EUR 603

GAN Protein Vector (Rat) (pPM-C-His)

PV269641 500 ng
EUR 603

GAN Protein Vector (Mouse) (pPB-C-His)

PV181198 500 ng
EUR 603

GAN Protein Vector (Mouse) (pPB-N-His)

PV181199 500 ng
EUR 603

GAN Protein Vector (Mouse) (pPM-C-HA)

PV181200 500 ng
EUR 603

GAN Protein Vector (Mouse) (pPM-C-His)

PV181201 500 ng
EUR 603

Gan 3'UTR Luciferase Stable Cell Line

TU204945 1.0 ml Ask for price

Gan 3'UTR GFP Stable Cell Line

TU156903 1.0 ml Ask for price

GAN 3'UTR Luciferase Stable Cell Line

TU008547 1.0 ml
EUR 1521

Gan 3'UTR Luciferase Stable Cell Line

TU106903 1.0 ml Ask for price

GAN 3'UTR GFP Stable Cell Line

TU058547 1.0 ml
EUR 1521

Gan 3'UTR GFP Stable Cell Line

TU254945 1.0 ml Ask for price

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human GAN(Gigaxonin) ELISA Kit