Human DTNb(Dystrobrevin Beta) ELISA Kit

Human DTNb(Dystrobrevin Beta) ELISA Kit

Human Dystrobrevin Beta (DTNb) ELISA Kit

RDR-DTNb-Hu-48Tests 48 Tests
EUR 544

Human Dystrobrevin Beta (DTNb) ELISA Kit

RDR-DTNb-Hu-96Tests 96 Tests
EUR 756

Human Dystrobrevin Beta (DTNb) ELISA Kit

RD-DTNb-Hu-48Tests 48 Tests
EUR 521

Human Dystrobrevin Beta (DTNb) ELISA Kit

RD-DTNb-Hu-96Tests 96 Tests
EUR 723

Human Dystrobrevin beta, DTNB ELISA KIT

ELI-09370h 96 Tests
EUR 824

Human Dystrobrevin beta (DTNb) ELISA Kit

20-abx151363
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dystrobrevin Beta(DTNb)ELISA Kit

QY-E00444 96T
EUR 374

Human Dystrobrevin Beta (DTNb) ELISA Kit

SEF385Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit

SEF385Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit

SEF385Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit

SEF385Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dystrobrevin Beta (DTNb) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dystrobrevin Beta (DTNb) in Tissue homogenates and other biological fluids.

Human Dystrobrevin Beta (DTNb) ELISA Kit

4-SEF385Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dystrobrevin Beta elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dystrobrevin Beta (DTNb) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Dystrobrevin Beta (DTNB) Antibody

20-abx112211
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Beta (DTNb) Antibody

20-abx130457
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dystrobrevin Beta (DTNB) Antibody

abx122407-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Dystrobrevin Beta (DTNb) Antibody

20-abx172179
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dystrobrevin Beta (DTNB) Antibody

20-abx339607
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Beta (DTNB) Antibody

20-abx210815
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Beta (DTNB) Antibody

abx232551-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Recombinant Dystrobrevin Beta (DTNb)

4-RPF385Hu01
  • EUR 460.19
  • EUR 226.00
  • EUR 1450.72
  • EUR 550.24
  • EUR 1000.48
  • EUR 371.00
  • EUR 3476.80
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O60941
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 32.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dystrobrevin Beta expressed in: E.coli

Mouse Dystrobrevin beta, Dtnb ELISA KIT

ELI-47723m 96 Tests
EUR 865

Human Dystrobrevin Beta (DTNb) Protein

20-abx650657
  • EUR 648.00
  • EUR 272.00
  • EUR 1957.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Dystrobrevin beta (DTNb) CLIA Kit

20-abx494887
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human DTNb (Dystrobrevin Beta)

ELK3317 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dystrobrevin Beta (DTN?). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dystrobre
  • Show more
Description: A sandwich ELISA kit for detection of Dystrobrevin Beta from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Dystrobrevin beta (DTNB)

KTE61971-48T 48T
EUR 332
  • Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dystrobrevin beta (DTNB)

KTE61971-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Dystrobrevin beta (DTNB)

KTE61971-96T 96T
EUR 539
  • Dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and bet
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Dystrobrevin beta (DTNB) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human)

4-PAF385Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb)

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC

4-PAF385Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Biotinylated

4-PAF385Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Biotin.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), Cy3

4-PAF385Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with Cy3.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), FITC

4-PAF385Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with FITC.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), HRP

4-PAF385Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with HRP.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), PE

4-PAF385Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with PE.

Dystrobrevin Beta (DTNb) Polyclonal Antibody (Human), APC-Cy7

4-PAF385Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DTNb (Met1~Glu249)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dystrobrevin Beta (DTNb). This antibody is labeled with APC-Cy7.

Recombinant human Dystrobrevin beta

P2840 100ug Ask for price
  • Uniprot ID: O60941
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Dystrobrevin beta

anti-Dystrobrevin beta

YF-PA11436 50 ul
EUR 363
Description: Mouse polyclonal to Dystrobrevin beta

anti-Dystrobrevin beta

YF-PA11437 50 ug
EUR 363
Description: Mouse polyclonal to Dystrobrevin beta

anti-Dystrobrevin beta

YF-PA23608 50 ul
EUR 334
Description: Mouse polyclonal to Dystrobrevin beta

Dtnb/ Rat Dtnb ELISA Kit

ELI-47526r 96 Tests
EUR 886

Anti-Dystrobrevin beta (1D3)

YF-MA12738 100 ug
EUR 363
Description: Mouse monoclonal to Dystrobrevin beta

DTNB ELISA KIT|Human

EF009230 96 Tests
EUR 689

DTNB ELISA Kit (Human) (OKCD00463)

OKCD00463 96 Wells
EUR 831
Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.053 ng/mL

DTNb ELISA Kit (Human) (OKDD00246)

OKDD00246 96 Wells
EUR 975
Description: Description of target: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.055 ng/mL

Human Dystrobrevin alpha, DTNA ELISA KIT

ELI-31605h 96 Tests
EUR 824

Human Dystrobrevin Alpha (DTNA) ELISA Kit

abx386993-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Dystrobrevin Alpha(DTNa)ELISA Kit

QY-E00445 96T
EUR 374

DTNB

HY-15915 5g
EUR 147

Mouse Dystrobrevin alpha, Dtna ELISA KIT

ELI-47722m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

DTNB siRNA

20-abx901595
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DTNB siRNA

20-abx914688
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DTNB siRNA

20-abx914689
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DTNB antibody

70R-3432 50 ug
EUR 467
Description: Rabbit polyclonal DTNB antibody raised against the C terminal of DTNB

DTNB Antibody

36425-100ul 100ul
EUR 252

DTNB antibody

10R-6896 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody

10R-6897 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody

10R-6898 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody

10R-6899 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody

10R-6900 100 ul
EUR 691
Description: Mouse monoclonal DTNB antibody

DTNB antibody

70R-16945 50 ul
EUR 435
Description: Rabbit polyclonal DTNB antibody

DTNB Antibody

1-CSB-PA007217GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DTNB Antibody

1-CSB-PA756613
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

DTNB Antibody

1-CSB-PA187891
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against DTNB. Recognizes DTNB from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

Human Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit

abx250983-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Human DTNB shRNA Plasmid

20-abx951286
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DTNB Recombinant Protein (Human)

RP009880 100 ug Ask for price

anti-Dystrobrevin alpha

YF-PA11433 50 ug
EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha

anti-Dystrobrevin alpha

YF-PA11434 50 ul
EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha

anti-Dystrobrevin alpha

YF-PA11435 50 ug
EUR 363
Description: Mouse polyclonal to Dystrobrevin alpha

DTNB Conjugated Antibody

C36425 100ul
EUR 397

DTNB cloning plasmid

CSB-CL007217HU-10ug 10ug
EUR 581
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1683
  • Sequence: atgattgaggaaagtgggaacaagcggaagaccatggcagagaagaggcagctgttcatagaaatgcgtgctcagaattttgatgtcatacgactatcaacttacagaacagcctgcaaattacgatttgtacaaaaacgatgcaaccttcatcttgttgatatctggaacatga
  • Show more
Description: A cloning plasmid for the DTNB gene.

anti- DTNB antibody

FNab02551 100µg
EUR 548.75
  • Immunogen: dystrobrevin, beta
  • Uniprot ID: O60941
  • Gene ID: 1838
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against DTNB

DTNB Rabbit pAb

A12866-100ul 100 ul
EUR 308

DTNB Rabbit pAb

A12866-200ul 200 ul
EUR 459

DTNB Rabbit pAb

A12866-20ul 20 ul
EUR 183

DTNB Rabbit pAb

A12866-50ul 50 ul
EUR 223

DTNB Blocking Peptide

33R-1524 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DTNB antibody, catalog no. 70R-3432

Anti-DTNB antibody

PAab02551 100 ug
EUR 386

pCMV-SPORT6-DTNB

PVT12852 2 ug
EUR 391

Anti-DTNB antibody

STJ114732 100 µl
EUR 277
Description: This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin.

DTNB (Ellman's Reagent)

DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

DTNB ORF Vector (Human) (pORF)

ORF003294 1.0 ug DNA
EUR 95

Cow Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit

abx517260-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Chicken Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit

abx517261-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit

abx517263-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Dystrobrevin Binding Protein 1 (DTNBP1) ELISA Kit

abx517264-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Dystrobrevin Alpha (DTNA) Antibody

20-abx125789
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody

20-abx112210
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody

abx026894-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody

abx026894-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dystrobrevin Alpha (DTNA) Antibody

abx232550-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat DTNB shRNA Plasmid

20-abx990429
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse DTNB shRNA Plasmid

20-abx970075
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DTNB Recombinant Protein (Rat)

RP198725 100 ug Ask for price

DTNB Recombinant Protein (Mouse)

RP130163 100 ug Ask for price

DTNB Recombinant Protein (Mouse)

RP130166 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

DTNB sgRNA CRISPR Lentivector set (Human)

K0635701 3 x 1.0 ug
EUR 339

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Dtnb ORF Vector (Rat) (pORF)

ORF066243 1.0 ug DNA
EUR 506

Dtnb ORF Vector (Mouse) (pORF)

ORF043389 1.0 ug DNA
EUR 506

Dtnb ORF Vector (Mouse) (pORF)

ORF043390 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

DTNB sgRNA CRISPR Lentivector (Human) (Target 1)

K0635702 1.0 ug DNA
EUR 154

DTNB sgRNA CRISPR Lentivector (Human) (Target 2)

K0635703 1.0 ug DNA
EUR 154

DTNB sgRNA CRISPR Lentivector (Human) (Target 3)

K0635704 1.0 ug DNA
EUR 154

DTNB Protein Vector (Human) (pPB-C-His)

PV013173 500 ng
EUR 329

DTNB Protein Vector (Human) (pPB-N-His)

PV013174 500 ng
EUR 329

DTNB Protein Vector (Human) (pPM-C-HA)

PV013175 500 ng
EUR 329

DTNB Protein Vector (Human) (pPM-C-His)

PV013176 500 ng
EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Human beta Thromboglobulin (beta-TG) ELISA Kit

abx574328-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Beta lactoglobulin, Beta-LG ELISA Kit

ELA-E1023h 96 Tests
EUR 824

Human Beta-TG(Beta-thromboglobulin) ELISA Kit

EH0874 96T
EUR 524.1
  • Detection range: 0.312-20 ng/ml
  • Alias: β-TG(β-Thromboglobulin)/Beta-TG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human beta Thromboglobulin (beta-TG) ELISA Kit

20-abx150805
  • EUR 6642.00
  • EUR 3542.00
  • EUR 825.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human beta Thromboglobulin (beta-TG) ELISA Kit

abx253398-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human beta Thromboglobulin (beta-TG) ELISA Kit

abx253830-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C

7-04999 5µg Ask for price

Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C

7-05000 20µg Ask for price

Recombinant Human Dystrobrevin-Binding Protein 1 Isoform C

7-05001 1mg Ask for price

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

abx117130-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

20-abx130940
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

20-abx130941
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

20-abx001375
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody

abx031648-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody

abx031648-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody

abx031649-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (Dtnbp1) Antibody

abx031649-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

abx028982-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

abx028982-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

20-abx339074
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

20-abx334159
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dystrobrevin Binding Protein 1 (DTNBP1) Antibody

20-abx210645
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Dystrobrevin Binding Protein 1 (DTNBP1)

4-RPC444Hu01
  • EUR 279.20
  • EUR 178.00
  • EUR 772.00
  • EUR 324.00
  • EUR 548.00
  • EUR 250.00
  • EUR 1780.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q96EV8
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 31.9kDa
  • Isoelectric Point: 4.3
Description: Recombinant Human Dystrobrevin Binding Protein 1 expressed in: E.coli

Recombinant Dystrobrevin Binding Protein 1 (DTNBP1)

4-RPC444Mu01
  • EUR 386.72
  • EUR 206.00
  • EUR 1175.20
  • EUR 458.40
  • EUR 816.80
  • EUR 322.00
  • EUR 2788.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q91WZ8
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 19.5kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Dystrobrevin Binding Protein 1 expressed in: E.coli

Recombinant Dystrobrevin Binding Protein 1 (DTNBP1)

4-RPC444Ra01
  • EUR 395.68
  • EUR 209.00
  • EUR 1208.80
  • EUR 469.60
  • EUR 839.20
  • EUR 328.00
  • EUR 2872.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5M834
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 26.0kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Dystrobrevin Binding Protein 1 expressed in: E.coli

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Dtnb sgRNA CRISPR Lentivector set (Mouse)

K4670501 3 x 1.0 ug
EUR 339

Dtnb sgRNA CRISPR Lentivector set (Rat)

K6438701 3 x 1.0 ug
EUR 339

ELISA kit for Human Beta-Endorphin (Beta-EP)  Kit

KTE62451-48T 48T
EUR 354
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Beta-Endorphin (Beta-EP)  Kit

KTE62451-5platesof96wells 5 plates of 96 wells
EUR 2252
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Beta-Endorphin (Beta-EP)  Kit

KTE62451-96T 96T
EUR 572
Description: Quantitative sandwich ELISA for measuring Human Beta-Endorphin (Beta-EP)  Kit in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human beta Endorphin ELISA kit

E01E0219-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta Endorphin ELISA kit

E01E0219-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta Endorphin ELISA kit

E01E0219-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human beta Endorphin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-taxilin ELISA kit

E01B0982-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-taxilin ELISA kit

E01B0982-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta-taxilin ELISA kit

E01B0982-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Beta-taxilin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta hydroxybutyrate ELISA kit

E01B1010-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta hydroxybutyrate ELISA kit

E01B1010-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta hydroxybutyrate ELISA kit

E01B1010-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Beta hydroxybutyrate in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta lactoglobulin ELISA kit

E01L0012-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta lactoglobulin ELISA kit

E01L0012-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human beta lactoglobulin ELISA kit

E01L0012-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human beta lactoglobulin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Beta mannosidase ELISA Kit

ELA-E0197h 96 Tests
EUR 824

Human Beta-LI ELISA Kit

EHB0653 96Tests
EUR 521

Human Beta-APP42 ELISA Kit

ELA-E1151h 96 Tests
EUR 824

Human Klotho Beta ELISA Kit

ELA-E13546h 96 Tests
EUR 824

Human Beta- Defensins ELISA Kit

ELA-E1373h 96 Tests
EUR 824

Human Amylase Beta ELISA Kit

ELA-E2216h 96 Tests
EUR 824

Human Beta- galactoyl ELISA Kit

ELA-E2301h 96 Tests
EUR 824

TFIIE beta ELISA KIT|Human

EF003561 96 Tests
EUR 689

Tubulin-beta ELISA KIT|Human

EF003944 96 Tests
EUR 689

Beta-TG ELISA KIT|Human

EF001460 96 Tests
EUR 689

beta glucan ELISA KIT|Human

EF007360 96 Tests
EUR 689

Beta adducin ELISA KIT|Human

EF008106 96 Tests
EUR 689

Beta sarcoglycan ELISA KIT|Human

EF008107 96 Tests
EUR 689

Importin beta ELISA KIT|Human

EF010333 96 Tests
EUR 689

Human IL1 beta ELISA kit

55R-1605 1 kit
EUR 415
Description: ELISA kit for the detection of IL1 beta in the research laboratory

Human TNF beta ELISA kit

55R-1717 1 kit
EUR 415
Description: ELISA kit for the detection of TNF beta in the research laboratory

Human IFN beta ELISA kit

55R-2176 96 tests
EUR 766
Description: ELISA Kit for detection of IFNb in the research laboratory

Human TNF beta ELISA kit

55R-IB49601 96 wells
EUR 1178
Description: ELISA kit for the detection of TNF beta in the research laboratory

Human IL1 beta ELISA kit

55R-IB49624 96 wells
EUR 1178
Description: ELISA kit for the detection of IL1 beta in the research laboratory

Beta-NGF (human) ELISA Kit

K4787-100 100 assays
EUR 834
  • Kit components:
  • Beta-NGF Ab coated plate (Item A), 96 wells
  • Wash Buffer Concentrate (20x) (Item B)
  • Human Beta-NGF Standard (Item C)
  • Assay Diluent (5x) (Item E)
  • Biotinylated anti-human Beta-NGF Ab (Item F)
  • HRP-Streptavidin Concentrate (8
  • Show more
Description: Sensitive, Colorimetric Assay

Human Beta-naphthol ELISA Kit

CN-04545H1 96T
EUR 441

Human Beta-naphthol ELISA Kit

CN-04545H2 48T
EUR 291

Human DTNb(Dystrobrevin Beta) ELISA Kit