Human DIAPH1(Diaphanous Homolog 1) ELISA Kit
Human DIAPH1(Diaphanous Homolog 1) ELISA Kit
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
RDR-DIAPH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
RDR-DIAPH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
RD-DIAPH1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
RD-DIAPH1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit |
201-12-2655 |
SunredBio |
96 tests |
EUR 440 |
- This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
SEJ265Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids. |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
SEJ265Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids. |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
SEJ265Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids. |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
SEJ265Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids. |
Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit |
4-SEJ265Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Diaphanous Homolog 1 elisa. Alternative names of the recognized antigen: DFNA1
- DRF1
- LFHL1
- hDIA1
- Diaphanous-related formin-1
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Diaphanous Homolog 1 (DIAPH1) Antibody |
20-abx112060 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 1 (DIAPH1) Antibody |
20-abx130946 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Diaphanous Homolog 1 (DIAPH1) Antibody |
20-abx172111 |
Abbexa |
|
|
|
Recombinant Diaphanous Homolog 1 (DIAPH1) |
4-RPJ265Hu01 |
Cloud-Clone |
-
EUR 494.24
-
EUR 235.00
-
EUR 1578.40
-
EUR 592.80
-
EUR 1085.60
-
EUR 394.00
-
EUR 3796.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Inquire
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 54.5kDa
- Isoelectric Point: 5.7
|
Description: Recombinant Human Diaphanous Homolog 1 expressed in: E.coli |
Human Diaphanous Homolog 1 (DIAPH1) Protein |
20-abx168221 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) ELISA Kit |
20-abx151314 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT |
ELI-08272h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human DIAPH1 (Diaphanous Homolog 1) |
ELK3618 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diaphanous Homolog 1 (DIAPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diap
- Show more
|
Description: A sandwich ELISA kit for detection of Diaphanous Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody |
20-abx004420 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody |
abx122868-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody |
abx431205-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Mouse Protein diaphanous homolog 1, Diaph1 ELISA KIT |
ELI-26053m |
Lifescience Market |
96 Tests |
EUR 865 |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human) |
4-PAJ265Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1) |
Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) CLIA Kit |
20-abx495656 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1) |
KTE62409-48T |
Abbkine |
48T |
EUR 332 |
- DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1) |
KTE62409-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1) |
KTE62409-96T |
Abbkine |
96T |
EUR 539 |
- DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1) |
KTE71284-48T |
Abbkine |
48T |
EUR 332 |
- Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1) |
KTE71284-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1) |
KTE71284-96T |
Abbkine |
96T |
EUR 539 |
- Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC |
4-PAJ265Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Biotinylated |
4-PAJ265Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Biotin. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Cy3 |
4-PAJ265Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Cy3. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), FITC |
4-PAJ265Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with FITC. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), HRP |
4-PAJ265Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with HRP. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), PE |
4-PAJ265Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with PE. |
Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAJ265Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC-Cy7. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human Protein diaphanous homolog 3, DIAPH3 ELISA KIT |
ELI-08892h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Diaphanous Homolog 3 (Drosophila) (DIAPH3) ELISA Kit |
abx386886-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Protein diaphanous homolog 2, DIAPH2 ELISA KIT |
ELI-32025h |
Lifescience Market |
96 Tests |
EUR 824 |
ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3) |
KTE62059-48T |
Abbkine |
48T |
EUR 332 |
- DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3) |
KTE62059-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3) |
KTE62059-96T |
Abbkine |
96T |
EUR 539 |
- DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2) |
KTE62060-48T |
Abbkine |
48T |
EUR 332 |
- The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2) |
KTE62060-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2) |
KTE62060-96T |
Abbkine |
96T |
EUR 539 |
- The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Mouse Protein diaphanous homolog 3, Diaph3 ELISA KIT |
ELI-09193m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Protein diaphanous homolog 2, Diaph2 ELISA KIT |
ELI-26818m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3) |
KTE71282-48T |
Abbkine |
48T |
EUR 332 |
- DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3) |
KTE71282-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3) |
KTE71282-96T |
Abbkine |
96T |
EUR 539 |
- DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2) |
KTE71283-48T |
Abbkine |
48T |
EUR 332 |
- The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2) |
KTE71283-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2) |
KTE71283-96T |
Abbkine |
96T |
EUR 539 |
- The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
DIAPH1 ELISA Kit (Human) (OKCD09173) |
OKCD09173 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL |
DIAPH1 ELISA Kit (Human) (OKDD00229) |
OKDD00229 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL |
DIAPH1 ELISA Kit (Human) (OKEH08375) |
OKEH08375 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098ng/mL |
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
20-abx003832 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
20-abx112061 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
20-abx125761 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
abx028919-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
abx028919-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
abx432603-200ul |
Abbexa |
200 ul |
EUR 286 |
- Shipped within 1-3 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
20-abx301045 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody |
abx232386-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (HRP) |
20-abx315532 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (FITC) |
20-abx315533 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (Biotin) |
20-abx315534 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
DIAPH1 antibody |
70R-12637 |
Fitzgerald |
100 ul |
EUR 457 |
Description: Affinity purified Rabbit polyclonal DIAPH1 antibody |
DIAPH1 antibody |
70R-21513 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal DIAPH1 antibody |
DIAPH1 Antibody |
33034-100ul |
SAB |
100ul |
EUR 252 |
DIAPH1 Antibody |
33105-100ul |
SAB |
100ul |
EUR 252 |
DIAPH1 Antibody |
49974-100ul |
SAB |
100ul |
EUR 333 |
DIAPH1 Antibody |
49974-50ul |
SAB |
50ul |
EUR 239 |
DIAPH1 Antibody |
1-CSB-PA006890GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against DIAPH1. Recognizes DIAPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF |
DIAPH1 siRNA |
20-abx914148 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
DIAPH1 siRNA |
20-abx914149 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-DIAPH1 |
YF-PA11357 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to DIAPH1 |
anti-DIAPH1 |
YF-PA11358 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to DIAPH1 |
anti-DIAPH1 |
YF-PA11359 |
Abfrontier |
100 ug |
EUR 403 |
Description: Rabbit polyclonal to DIAPH1 |
anti-DIAPH1 |
YF-PA23588 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to DIAPH1 |
Human DIAPH1 shRNA Plasmid |
20-abx951198 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
DIAPH1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K0602102 |
ABM |
1.0 ug DNA |
EUR 154 |
DIAPH1 Rabbit mAb |
A11596-100ul |
Abclonal |
100 ul |
EUR 410 |
DIAPH1 Rabbit mAb |
A11596-200ul |
Abclonal |
200 ul |
EUR 571 |
DIAPH1 Rabbit mAb |
A11596-20ul |
Abclonal |
20 ul |
EUR 221 |
DIAPH1 Rabbit mAb |
A11596-50ul |
Abclonal |
50 ul |
EUR 287 |
DIAPH1 Conjugated Antibody |
C49974 |
SAB |
100ul |
EUR 397 |
DIAPH1 Conjugated Antibody |
C33034 |
SAB |
100ul |
EUR 397 |
DIAPH1 cloning plasmid |
CSB-CL006890HU-10ug |
Cusabio |
10ug |
EUR 1333 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 3789
- Sequence: atggagccgcccggcgggagcctggggcccggccgcgggacccgggacaagaagaagggccggagcccagatgagctgccctcggcgggcggcgacggcggcaaatctaagaaatttctggagagatttaccagcatgagaattaagaaggagaaggaaaagcccaattctgctc
- Show more
|
Description: A cloning plasmid for the DIAPH1 gene. |
DIAPH1 Rabbit pAb |
A5772-100ul |
Abclonal |
100 ul |
EUR 308 |
DIAPH1 Rabbit pAb |
A5772-200ul |
Abclonal |
200 ul |
EUR 459 |
DIAPH1 Rabbit pAb |
A5772-20ul |
Abclonal |
20 ul |
EUR 183 |
DIAPH1 Rabbit pAb |
A5772-50ul |
Abclonal |
50 ul |
EUR 223 |
Anti-DIAPH1 antibody |
STJ11100054 |
St John's Laboratory |
100 µl |
EUR 413 |
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. |
Anti-DIAPH1 antibody |
STJ28339 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. |
Anti-DIAPH1 (5A8) |
YF-MA12678 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DIAPH1 |
Anti-DIAPH1 (1A8) |
YF-MA12679 |
Abfrontier |
100 ug |
EUR 363 |
Description: Mouse monoclonal to DIAPH1 |
DIAPH1 ORF Vector (Human) (pORF) |
ORF012840 |
ABM |
1.0 ug DNA |
EUR 354 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Anti-CELSR3/Flamingo Homolog 1 Antibody |
A07204-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Human Notch Homolog 1 ELISA kit |
E01N0594-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Notch Homolog 1 ELISA kit |
E01N0594-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
DIAPH1 Polyclonal Conjugated Antibody |
C30293 |
SAB |
100ul |
EUR 397 |
Mouse DIAPH1 shRNA Plasmid |
20-abx970001 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
DIAPH1 sgRNA CRISPR Lentivector set (Human) |
K0602101 |
ABM |
3 x 1.0 ug |
EUR 339 |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Frizzled Homolog 1 (FZD1)ELISA Kit |
201-12-2369 |
SunredBio |
96 tests |
EUR 440 |
- This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Slit Homolog 1 (Slit1)ELISA Kit |
201-12-2565 |
SunredBio |
96 tests |
EUR 440 |
- This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Disabled Homolog 1 (DAB1)ELISA Kit |
201-12-2657 |
SunredBio |
96 tests |
EUR 440 |
- This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Atonal Homolog 1 (ATOH1)ELISA Kit |
201-12-2838 |
SunredBio |
96 tests |
EUR 440 |
- This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Chromobox Homolog 1 (CBX1)ELISA Kit |
201-12-2894 |
SunredBio |
96 tests |
EUR 440 |
- This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Human Disabled Homolog 1 (DAB1) ELISA Kit |
DLR-DAB1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids. |
Human Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Slit Homolog 1 (Slit1) ELISA Kit |
DLR-Slit1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Snail Homolog 1 (SNAI1) ELISA Kit |
DLR-SNAI1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Snail Homolog 1 (SNAI1) ELISA Kit |
DLR-SNAI1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Slingshot Homolog 1 (SSH1) ELISA Kit |
DLR-SSH1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids. |
Human Slingshot Homolog 1 (SSH1) ELISA Kit |
DLR-SSH1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
DLR-MLH1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human MutL Homolog 1 (MLH1) ELISA Kit |
DLR-MLH1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids. |
Human Frizzled Homolog 1 (FZD1) ELISA Kit |
DLR-FZD1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids. |
Human Frizzled Homolog 1 (FZD1) ELISA Kit |
DLR-FZD1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids. |
Human Roundabout homolog 1(ROBO1) ELISA kit |
CSB-EL020054HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human DIAPH1(Diaphanous Homolog 1) ELISA Kit