Human DIAPH1(Diaphanous Homolog 1) ELISA Kit

Human DIAPH1(Diaphanous Homolog 1) ELISA Kit

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

RDR-DIAPH1-Hu-48Tests 48 Tests
EUR 544

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

RDR-DIAPH1-Hu-96Tests 96 Tests
EUR 756

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

RD-DIAPH1-Hu-48Tests 48 Tests
EUR 521

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

RD-DIAPH1-Hu-96Tests 96 Tests
EUR 723

Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit

201-12-2655 96 tests
EUR 440
  • This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Diaphanous Homolog 1(DIAPH1)ELISA Kit

QY-E04979 96T
EUR 374

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

SEJ265Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

SEJ265Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

SEJ265Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

SEJ265Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit

4-SEJ265Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Diaphanous Homolog 1 elisa. Alternative names of the recognized antigen: DFNA1
  • DRF1
  • LFHL1
  • hDIA1
  • Diaphanous-related formin-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Diaphanous Homolog 1 (DIAPH1) Antibody

20-abx112060
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diaphanous Homolog 1 (DIAPH1) Antibody

20-abx130946
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Diaphanous Homolog 1 (DIAPH1) Antibody

20-abx172111
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Diaphanous Homolog 1 (DIAPH1)

4-RPJ265Hu01
  • EUR 494.24
  • EUR 235.00
  • EUR 1578.40
  • EUR 592.80
  • EUR 1085.60
  • EUR 394.00
  • EUR 3796.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 54.5kDa
  • Isoelectric Point: 5.7
Description: Recombinant Human Diaphanous Homolog 1 expressed in: E.coli

Human Diaphanous Homolog 1 (DIAPH1) Protein

20-abx168221
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) ELISA Kit

20-abx151314
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT

ELI-08272h 96 Tests
EUR 824

ELISA kit for Human DIAPH1 (Diaphanous Homolog 1)

ELK3618 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diaphanous Homolog 1 (DIAPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diap
  • Show more
Description: A sandwich ELISA kit for detection of Diaphanous Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody

20-abx004420
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody

abx122868-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody

abx431205-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Mouse Protein diaphanous homolog 1, Diaph1 ELISA KIT

ELI-26053m 96 Tests
EUR 865

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human)

4-PAJ265Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1)

Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) CLIA Kit

20-abx495656
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)

KTE62409-48T 48T
EUR 332
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)

KTE62409-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)

KTE62409-96T 96T
EUR 539
  • DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)

KTE71284-48T 48T
EUR 332
  • Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)

KTE71284-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)

KTE71284-96T 96T
EUR 539
  • Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC

4-PAJ265Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Biotinylated

4-PAJ265Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Biotin.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Cy3

4-PAJ265Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Cy3.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), FITC

4-PAJ265Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with FITC.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), HRP

4-PAJ265Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with HRP.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), PE

4-PAJ265Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with PE.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC-Cy7

4-PAJ265Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DIAPH1 (Asp389~Pro583)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Human Protein diaphanous homolog 3, DIAPH3 ELISA KIT

ELI-08892h 96 Tests
EUR 824

Human Diaphanous Homolog 3 (Drosophila) (DIAPH3) ELISA Kit

abx386886-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Protein diaphanous homolog 2, DIAPH2 ELISA KIT

ELI-32025h 96 Tests
EUR 824

ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)

KTE62059-48T 48T
EUR 332
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)

KTE62059-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)

KTE62059-96T 96T
EUR 539
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)

KTE62060-48T 48T
EUR 332
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)

KTE62060-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)

KTE62060-96T 96T
EUR 539
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Protein diaphanous homolog 3, Diaph3 ELISA KIT

ELI-09193m 96 Tests
EUR 865

Mouse Protein diaphanous homolog 2, Diaph2 ELISA KIT

ELI-26818m 96 Tests
EUR 865

ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)

KTE71282-48T 48T
EUR 332
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)

KTE71282-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)

KTE71282-96T 96T
EUR 539
  • DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)

KTE71283-48T 48T
EUR 332
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)

KTE71283-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)

KTE71283-96T 96T
EUR 539
  • The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DIAPH1 ELISA Kit (Human) (OKCD09173)

OKCD09173 96 Wells
EUR 975
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL

DIAPH1 ELISA Kit (Human) (OKDD00229)

OKDD00229 96 Wells
EUR 975
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL

DIAPH1 ELISA Kit (Human) (OKEH08375)

OKEH08375 96 Wells
EUR 896
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098ng/mL

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

20-abx003832
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

20-abx112061
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

20-abx125761
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

abx028919-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

abx028919-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

abx432603-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

20-abx301045
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody

abx232386-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (HRP)

20-abx315532
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (FITC)

20-abx315533
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (Biotin)

20-abx315534
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

DIAPH1 antibody

70R-12637 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal DIAPH1 antibody

DIAPH1 antibody

70R-21513 50 ul
EUR 435
Description: Rabbit polyclonal DIAPH1 antibody

DIAPH1 Antibody

33034-100ul 100ul
EUR 252

DIAPH1 Antibody

33105-100ul 100ul
EUR 252

DIAPH1 Antibody

49974-100ul 100ul
EUR 333

DIAPH1 Antibody

49974-50ul 50ul
EUR 239

DIAPH1 Antibody

1-CSB-PA006890GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DIAPH1. Recognizes DIAPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

DIAPH1 siRNA

20-abx914148
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DIAPH1 siRNA

20-abx914149
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-DIAPH1

YF-PA11357 50 ul
EUR 363
Description: Mouse polyclonal to DIAPH1

anti-DIAPH1

YF-PA11358 50 ug
EUR 363
Description: Mouse polyclonal to DIAPH1

anti-DIAPH1

YF-PA11359 100 ug
EUR 403
Description: Rabbit polyclonal to DIAPH1

anti-DIAPH1

YF-PA23588 50 ul
EUR 334
Description: Mouse polyclonal to DIAPH1

Human DIAPH1 shRNA Plasmid

20-abx951198
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

DIAPH1 sgRNA CRISPR Lentivector (Human) (Target 1)

K0602102 1.0 ug DNA
EUR 154

DIAPH1 Rabbit mAb

A11596-100ul 100 ul
EUR 410

DIAPH1 Rabbit mAb

A11596-200ul 200 ul
EUR 571

DIAPH1 Rabbit mAb

A11596-20ul 20 ul
EUR 221

DIAPH1 Rabbit mAb

A11596-50ul 50 ul
EUR 287

DIAPH1 Conjugated Antibody

C49974 100ul
EUR 397

DIAPH1 Conjugated Antibody

C33034 100ul
EUR 397

DIAPH1 cloning plasmid

CSB-CL006890HU-10ug 10ug
EUR 1333
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3789
  • Sequence: atggagccgcccggcgggagcctggggcccggccgcgggacccgggacaagaagaagggccggagcccagatgagctgccctcggcgggcggcgacggcggcaaatctaagaaatttctggagagatttaccagcatgagaattaagaaggagaaggaaaagcccaattctgctc
  • Show more
Description: A cloning plasmid for the DIAPH1 gene.

DIAPH1 Rabbit pAb

A5772-100ul 100 ul
EUR 308

DIAPH1 Rabbit pAb

A5772-200ul 200 ul
EUR 459

DIAPH1 Rabbit pAb

A5772-20ul 20 ul
EUR 183

DIAPH1 Rabbit pAb

A5772-50ul 50 ul
EUR 223

Anti-DIAPH1 antibody

STJ11100054 100 µl
EUR 413
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-DIAPH1 antibody

STJ28339 100 µl
EUR 277
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-DIAPH1 antibody

STJ71749 100 µg
EUR 359

Anti-DIAPH1 (5A8)

YF-MA12678 100 ug
EUR 363
Description: Mouse monoclonal to DIAPH1

Anti-DIAPH1 (1A8)

YF-MA12679 100 ug
EUR 363
Description: Mouse monoclonal to DIAPH1

DIAPH1 ORF Vector (Human) (pORF)

ORF012840 1.0 ug DNA
EUR 354

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody

A07204-1 100ul
EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Human Notch Homolog 1 ELISA kit

E01N0594-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit

E01N0594-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

DIAPH1 Polyclonal Conjugated Antibody

C30293 100ul
EUR 397

Mouse DIAPH1 shRNA Plasmid

20-abx970001
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DIAPH1 sgRNA CRISPR Lentivector set (Human)

K0602101 3 x 1.0 ug
EUR 339

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Frizzled Homolog 1 (FZD1)ELISA Kit

201-12-2369 96 tests
EUR 440
  • This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit Homolog 1 (Slit1)ELISA Kit

201-12-2565 96 tests
EUR 440
  • This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1)ELISA Kit

201-12-2657 96 tests
EUR 440
  • This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Atonal Homolog 1 (ATOH1)ELISA Kit

201-12-2838 96 tests
EUR 440
  • This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromobox Homolog 1 (CBX1)ELISA Kit

201-12-2894 96 tests
EUR 440
  • This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Hu-48T 48T
EUR 517
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit

DLR-DAB1-Hu-96T 96T
EUR 673
  • Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Hu-48T 48T
EUR 517
  • Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit

DLR-Slit1-Hu-96T 96T
EUR 673
  • Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit

DLR-SNAI1-Hu-48T 48T
EUR 517
  • Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit

DLR-SNAI1-Hu-96T 96T
EUR 673
  • Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit

DLR-SSH1-Hu-48T 48T
EUR 517
  • Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit

DLR-SSH1-Hu-96T 96T
EUR 673
  • Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit

DLR-MLH1-Hu-48T 48T
EUR 517
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit

DLR-MLH1-Hu-96T 96T
EUR 673
  • Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit

DLR-FZD1-Hu-48T 48T
EUR 517
  • Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit

DLR-FZD1-Hu-96T 96T
EUR 673
  • Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Roundabout homolog 1(ROBO1) ELISA kit

CSB-EL020054HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human DIAPH1(Diaphanous Homolog 1) ELISA Kit