Human DIAPH1(Diaphanous Homolog 1) ELISA Kit

Human DIAPH1(Diaphanous Homolog 1) ELISA Kit

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RDR-DIAPH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RDR-DIAPH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RD-DIAPH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
RD-DIAPH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Diaphanous Homolog 1 (DIAPH1)ELISA Kit
201-12-2655	SunredBio	96 tests	EUR 440
This Diaphanous Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Diaphanous Homolog 1(DIAPH1)ELISA Kit
QY-E04979	Qayee Biotechnology	96T	EUR 374

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
SEJ265Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Diaphanous Homolog 1 (DIAPH1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Diaphanous Homolog 1 (DIAPH1) in Tissue homogenates and other biological fluids.

Human Diaphanous Homolog 1 (DIAPH1) ELISA Kit
4-SEJ265Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Diaphanous Homolog 1 elisa. Alternative names of the recognized antigen: DFNA1 DRF1 LFHL1 hDIA1 Diaphanous-related formin-1
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Diaphanous Homolog 1 (DIAPH1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Diaphanous Homolog 1 (DIAPH1) Antibody
20-abx112060	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Diaphanous Homolog 1 (DIAPH1) Antibody
20-abx130946	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Diaphanous Homolog 1 (DIAPH1) Antibody
20-abx172111	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Recombinant Diaphanous Homolog 1 (DIAPH1)
4-RPJ265Hu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Inquire Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 54.5kDa Isoelectric Point: 5.7
Description: Recombinant Human Diaphanous Homolog 1 expressed in: E.coli

Human Diaphanous Homolog 1 (DIAPH1) Protein
20-abx168221	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) ELISA Kit
20-abx151314	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Protein diaphanous homolog 1, DIAPH1 ELISA KIT
ELI-08272h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human DIAPH1 (Diaphanous Homolog 1)
ELK3618	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Diaphanous Homolog 1 (DIAPH1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Diap Show more
Description: A sandwich ELISA kit for detection of Diaphanous Homolog 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody
20-abx004420	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody
abx122868-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Diaphanous Homolog 1 (Drosophila) (DIAPH1) Antibody
abx431205-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Mouse Protein diaphanous homolog 1, Diaph1 ELISA KIT
ELI-26053m	Lifescience Market	96 Tests	EUR 865

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human)
4-PAJ265Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1)

Human Diaphanous Homolog 1 (Drosophila) (DIAPH1) CLIA Kit
20-abx495656	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-48T	Abbkine	48T	EUR 332
DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 1 (DIAPH1)
KTE62409-96T	Abbkine	96T	EUR 539
DIAPH1 is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diapha Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)
KTE71284-48T	Abbkine	48T	EUR 332
Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)
KTE71284-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 1 (DIAPH1)
KTE71284-96T	Abbkine	96T	EUR 539
Diaph1 encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myel Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 1 (DIAPH1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC
4-PAJ265Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Biotinylated
4-PAJ265Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Biotin.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), Cy3
4-PAJ265Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with Cy3.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), FITC
4-PAJ265Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with FITC.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), HRP
4-PAJ265Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with HRP.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), PE
4-PAJ265Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with PE.

Diaphanous Homolog 1 (DIAPH1) Polyclonal Antibody (Human), APC-Cy7
4-PAJ265Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DIAPH1 (Asp389~Pro583) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Diaphanous Homolog 1 (DIAPH1). This antibody is labeled with APC-Cy7.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Human Protein diaphanous homolog 3, DIAPH3 ELISA KIT
ELI-08892h	Lifescience Market	96 Tests	EUR 824

Human Diaphanous Homolog 3 (Drosophila) (DIAPH3) ELISA Kit
abx386886-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Protein diaphanous homolog 2, DIAPH2 ELISA KIT
ELI-32025h	Lifescience Market	96 Tests	EUR 824

ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)
KTE62059-48T	Abbkine	48T	EUR 332
DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)
KTE62059-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 3 (DIAPH3)
KTE62059-96T	Abbkine	96T	EUR 539
DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)
KTE62060-48T	Abbkine	48T	EUR 332
The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)
KTE62060-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein diaphanous homolog 2 (DIAPH2)
KTE62060-96T	Abbkine	96T	EUR 539
The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in this gene have been linked to premature ovarian failure 2. A Show more
Description: Quantitative sandwich ELISA for measuring Human Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Protein diaphanous homolog 3, Diaph3 ELISA KIT
ELI-09193m	Lifescience Market	96 Tests	EUR 865

Mouse Protein diaphanous homolog 2, Diaph2 ELISA KIT
ELI-26818m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)
KTE71282-48T	Abbkine	48T	EUR 332
DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)
KTE71282-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 3 (DIAPH3)
KTE71282-96T	Abbkine	96T	EUR 539
DIAPH3 encodes a member of the diaphanous subfamily of the formin family. Members of this family are involved in actin remodeling and regulate cell movement and adhesion. Mutations in DIAPH3 are associated with autosomal dominant auditory neuropathy Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 3 (DIAPH3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)
KTE71283-48T	Abbkine	48T	EUR 332
The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)
KTE71283-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein diaphanous homolog 2 (DIAPH2)
KTE71283-96T	Abbkine	96T	EUR 539
The product of DIAPH2 belongs to the diaphanous subfamily of the formin homology family of proteins. DIAPH2 may play a role in the development and normal function of the ovaries. Defects in DIAPH2 have been linked to premature ovarian failure 2. Alte Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein diaphanous homolog 2 (DIAPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

DIAPH1 ELISA Kit (Human) (OKCD09173)
OKCD09173	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.051ng/mL

DIAPH1 ELISA Kit (Human) (OKDD00229)
OKDD00229	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.051 ng/mL

DIAPH1 ELISA Kit (Human) (OKEH08375)
OKEH08375	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.098ng/mL

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx003832	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx112061	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx125761	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx028919-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx028919-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx432603-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
20-abx301045	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody
abx232386-100ug	Abbexa	100 ug	EUR 551
Shipped within 5-12 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (HRP)
20-abx315532	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (FITC)
20-abx315533	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Diaphanous Homolog 3 (Drosophila) (DIAPH3) Antibody (Biotin)
20-abx315534	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

DIAPH1 antibody
70R-12637	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal DIAPH1 antibody

DIAPH1 antibody
70R-21513	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DIAPH1 antibody

DIAPH1 Antibody
33034-100ul	SAB	100ul	EUR 252

DIAPH1 Antibody
33105-100ul	SAB	100ul	EUR 252

DIAPH1 Antibody
49974-100ul	SAB	100ul	EUR 333

DIAPH1 Antibody
49974-50ul	SAB	50ul	EUR 239

DIAPH1 Antibody
1-CSB-PA006890GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DIAPH1. Recognizes DIAPH1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF

DIAPH1 siRNA
20-abx914148	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DIAPH1 siRNA
20-abx914149	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DIAPH1
YF-PA11357	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to DIAPH1

anti-DIAPH1
YF-PA11358	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DIAPH1

anti-DIAPH1
YF-PA11359	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to DIAPH1

anti-DIAPH1
YF-PA23588	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to DIAPH1

Human DIAPH1 shRNA Plasmid
20-abx951198	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

DIAPH1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0602102	ABM	1.0 ug DNA	EUR 154

DIAPH1 Rabbit mAb
A11596-100ul	Abclonal	100 ul	EUR 410

DIAPH1 Rabbit mAb
A11596-200ul	Abclonal	200 ul	EUR 571

DIAPH1 Rabbit mAb
A11596-20ul	Abclonal	20 ul	EUR 221

DIAPH1 Rabbit mAb
A11596-50ul	Abclonal	50 ul	EUR 287

DIAPH1 Conjugated Antibody
C49974	SAB	100ul	EUR 397

DIAPH1 Conjugated Antibody
C33034	SAB	100ul	EUR 397

DIAPH1 cloning plasmid
CSB-CL006890HU-10ug	Cusabio	10ug	EUR 1333
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3789 Sequence: atggagccgcccggcgggagcctggggcccggccgcgggacccgggacaagaagaagggccggagcccagatgagctgccctcggcgggcggcgacggcggcaaatctaagaaatttctggagagatttaccagcatgagaattaagaaggagaaggaaaagcccaattctgctc Show more
Description: A cloning plasmid for the DIAPH1 gene.

DIAPH1 Rabbit pAb
A5772-100ul	Abclonal	100 ul	EUR 308

DIAPH1 Rabbit pAb
A5772-200ul	Abclonal	200 ul	EUR 459

DIAPH1 Rabbit pAb
A5772-20ul	Abclonal	20 ul	EUR 183

DIAPH1 Rabbit pAb
A5772-50ul	Abclonal	50 ul	EUR 223

Anti-DIAPH1 antibody
STJ11100054	St John's Laboratory	100 µl	EUR 413
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-DIAPH1 antibody
STJ28339	St John's Laboratory	100 µl	EUR 277
Description: This gene is a homolog of the Drosophila diaphanous gene, and has been linked to autosomal dominant, fully penetrant, nonsyndromic sensorineural progressive low-frequency hearing loss. Actin polymerization involves proteins known to interact with diaphanous protein in Drosophila and mouse. It has therefore been speculated that this gene may have a role in the regulation of actin polymerization in hair cells of the inner ear. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Anti-DIAPH1 antibody
STJ71749	St John's Laboratory	100 µg	EUR 359

Anti-DIAPH1 (5A8)
YF-MA12678	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DIAPH1

Anti-DIAPH1 (1A8)
YF-MA12679	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to DIAPH1

DIAPH1 ORF Vector (Human) (pORF)
ORF012840	ABM	1.0 ug DNA	EUR 354

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Anti-CELSR3/Flamingo Homolog 1 Antibody
A07204-1	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal CELSR3/Flamingo Homolog 1 Antibody. Validated in IF and tested in Human, Mouse, Rat.

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Human Notch Homolog 1 ELISA kit
E01N0594-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Notch Homolog 1 ELISA kit
E01N0594-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Notch Homolog 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

DIAPH1 Polyclonal Conjugated Antibody
C30293	SAB	100ul	EUR 397

Mouse DIAPH1 shRNA Plasmid
20-abx970001	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

DIAPH1 sgRNA CRISPR Lentivector set (Human)
K0602101	ABM	3 x 1.0 ug	EUR 339

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Human Hexokinase-1 AssayMax ELISA Kit
EH3101-1	AssayPro	96 Well Plate	EUR 477

Human Complexin-1 AssayMax ELISA Kit
EC3505-1	AssayPro	96 Well Plate	EUR 417

Human Glutaredoxin-1 AssayMax ELISA Kit
EG2153-1	AssayPro	96 Well Plate	EUR 417

Human Frizzled Homolog 1 (FZD1)ELISA Kit
201-12-2369	SunredBio	96 tests	EUR 440
This Frizzled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit Homolog 1 (Slit1)ELISA Kit
201-12-2565	SunredBio	96 tests	EUR 440
This Slit Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1)ELISA Kit
201-12-2657	SunredBio	96 tests	EUR 440
This Disabled Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Atonal Homolog 1 (ATOH1)ELISA Kit
201-12-2838	SunredBio	96 tests	EUR 440
This Atonal Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Chromobox Homolog 1 (CBX1)ELISA Kit
201-12-2894	SunredBio	96 tests	EUR 440
This Chromobox Homolog 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Disabled Homolog 1 (DAB1) ELISA Kit
DLR-DAB1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Disabled Homolog 1 (DAB1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Disabled Homolog 1 (DAB1) in samples from tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Slit Homolog 1 (Slit1) ELISA Kit
DLR-Slit1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slit Homolog 1 (Slit1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slit Homolog 1 (Slit1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
DLR-SNAI1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Snail Homolog 1 (SNAI1) ELISA Kit
DLR-SNAI1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Snail Homolog 1 (SNAI1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Snail Homolog 1 (SNAI1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human Slingshot Homolog 1 (SSH1) ELISA Kit
DLR-SSH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Slingshot Homolog 1 (SSH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Slingshot Homolog 1 (SSH1) in samples from tissue homogenates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-48T	DL Develop	48T	EUR 517
Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human MutL Homolog 1 (MLH1) ELISA Kit
DLR-MLH1-Hu-96T	DL Develop	96T	EUR 673
Should the Human MutL Homolog 1 (MLH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MutL Homolog 1 (MLH1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Frizzled Homolog 1 (FZD1) ELISA Kit
DLR-FZD1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Frizzled Homolog 1 (FZD1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Frizzled Homolog 1 (FZD1) in samples from tissue homogenates or other biological fluids.

Human Roundabout homolog 1(ROBO1) ELISA kit
CSB-EL020054HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Roundabout homolog 1 (ROBO1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human DIAPH1(Diaphanous Homolog 1) ELISA Kit