Human AHNAK(Desmoyokin) ELISA Kit

Human AHNAK(Desmoyokin) ELISA Kit

Human Desmoyokin (AHNAK) ELISA Kit
RD-AHNAK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Desmoyokin (AHNAK) ELISA Kit
RDR-AHNAK-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Desmoyokin (AHNAK) ELISA Kit
RDR-AHNAK-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Desmoyokin (AHNAK)ELISA Kit
201-12-2651	SunredBio	96 tests	EUR 440
This Desmoyokin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit
20-abx151304	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Desmoyokin (AHNAK) ELISA Kit
abx572439-96tests	Abbexa	96 tests	EUR 848
Shipped within 5-12 working days.

Human Desmoyokin(AHNAK)ELISA Kit
QY-E01879	Qayee Biotechnology	96T	EUR 361

Human Desmoyokin ELISA Kit (AHNAK)
RK00851	Abclonal	96 Tests	EUR 521

Human Desmoyokin (AHNAK) ELISA Kit
SEJ661Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit
SEJ661Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit
SEJ661Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit
SEJ661Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Desmoyokin (AHNAK) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Desmoyokin (AHNAK) in tissue homogenates, cell lysates and other biological fluids.

Human Desmoyokin (AHNAK) ELISA Kit
4-SEJ661Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Desmoyokin elisa. Alternative names of the recognized antigen: AHNAKRS AHNAK Nucleoprotein Neuroblast differentiation-associated protein AHNAK
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Desmoyokin (AHNAK) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Desmoyokin (AHNAK) Antibody
20-abx129177	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Desmoyokin (AHNAK) Antibody
20-abx172102	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Desmoyokin (AHNAK) Antibody
20-abx333726	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Desmoyokin (AHNAK) Antibody
abx230230-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Desmoyokin (AHNAK)
4-RPJ661Hu01	Cloud-Clone	EUR 483.49 EUR 232.00 EUR 1538.08 EUR 579.36 EUR 1058.72 EUR 386.00 EUR 3695.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q09666 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 35.4kDa Isoelectric Point: Inquire
Description: Recombinant Human Desmoyokin expressed in: E.coli

ELISA kit for Human AHNAK (Desmoyokin)
ELK3322	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Desmoyokin (AHNAK). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Desmoyokin (AHN Show more
Description: A sandwich ELISA kit for detection of Desmoyokin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Desmoyokin (AHNAK) Protein
20-abx166829	Abbexa	EUR 676.00 EUR 272.00 EUR 2068.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Desmoyokin (AHNAK) CLIA Kit
20-abx495757	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Desmoyokin (AHNAK) Antibody (HRP)
20-abx336745	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Desmoyokin (AHNAK) Antibody (FITC)
20-abx336746	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Desmoyokin (AHNAK) Antibody (Biotin)
20-abx336747	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Desmoyokin (AHNAK) Polyclonal Antibody (Human)
4-PAJ661Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK)

Desmoyokin (AHNAK) Polyclonal Antibody (Human), APC
4-PAJ661Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with APC.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), Biotinylated
4-PAJ661Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with Biotin.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), Cy3
4-PAJ661Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with Cy3.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), FITC
4-PAJ661Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with FITC.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), HRP
4-PAJ661Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with HRP.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), PE
4-PAJ661Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with PE.

Desmoyokin (AHNAK) Polyclonal Antibody (Human), APC-Cy7
4-PAJ661Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: AHNAK (Met1~Asp300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Desmoyokin (AHNAK). This antibody is labeled with APC-Cy7.

Human AHNAK ELISA KIT
ELI-11966h	Lifescience Market	96 Tests	EUR 824

AHNAK ELISA KIT|Human
EF007669	Lifescience Market	96 Tests	EUR 689

AHNAK ELISA Kit (Human) (OKCD00575)
OKCD00575	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May be required for neuronal cell differentiation. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

Desmoyokin antibody
20R-2606	Fitzgerald	100 uL	EUR 571
Description: Guinea Pig polyclonal Desmoyokin antibody

Desmoyokin Antibody
DF10323	Affbiotech	200ul	EUR 304
Description: Desmoyokin Antibody detects endogenous levels of Desmoyokin.

Human AHNAK Nucleoprotein 2(AHNAK2)ELISA Kit
QY-E05162	Qayee Biotechnology	96T	EUR 400

Desmoyokin Blocking Peptide
DF10323-BP	Affbiotech	1mg	EUR 195

Desmoyokin (pS5782) Antibody
abx148069-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

AHNAK Antibody
47439-100ul	SAB	100ul	EUR 252

AHNAK antibody
10R-1317	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal AHNAK antibody

AHNAK Antibody
1-CSB-PA600257LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:500-1:1000, IF:1:50-1:200

AHNAK siRNA
20-abx907068	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-AHNAK
YF-PA20722	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to AHNAK

anti-AHNAK
YF-PA20723	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to AHNAK

anti-AHNAK
YF-PA20724	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to AHNAK

anti-AHNAK
YF-PA26592	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to AHNAK

Human AHNAK shRNA Plasmid
20-abx962263	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Desmoyokin (Phospho-Ser5782) Antibody
12452-100ul	SAB	100ul	EUR 252

Desmoyokin (Phospho-Ser5782) Antibody
12452-50ul	SAB	50ul	EUR 187

Phospho-Desmoyokin (Ser5782) Antibody
AF8084	Affbiotech	200ul	EUR 376
Description: Desmoyokin (Phospho-Ser5782) Antibody detects endogenous levels of Desmoyokin only when phosphorylated at Ser5782.

Desmoyokin (Phospho- Ser5782) Antibody
ABF8084	Lifescience Market	100 ug	EUR 438

AHNAK Conjugated Antibody
C47439	SAB	100ul	EUR 397

AHNAK cloning plasmid
CSB-CL600257HU1-10ug	Cusabio	10ug	EUR 236
Formulation: 10 μg plasmid + 200μl Glycerol Length: 450 Sequence: atggagaaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgccac Show more
Description: A cloning plasmid for the AHNAK gene.

AHNAK cloning plasmid
CSB-CL600257HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 453 Sequence: atggagaaggaggaggagacaacccgggagctgctgctgcccaactggcagggtagtggctcccacgggctgaccatcgcccagagggacgacggcgtctttgtgcaggaggtgacgcagaactcccctgcggcccgcactggggtggtcaaggagggggaccagattgtgggtgc Show more
Description: A cloning plasmid for the AHNAK gene.

AHNAK Polyclonal Antibody
A68819	EpiGentek	100 ?g	EUR 628.55
Description: fast delivery possible

anti- AHNAK antibody
FNab00230	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500-1:5000 IF: 1:50-1:500 Immunogen: AHNAK nucleoprotein Uniprot ID: Q09666 Gene ID: 79026 Research Area: Developmental biology
Description: Antibody raised against AHNAK

Anti-AHNAK antibody
PAab00230	Lifescience Market	100 ug	EUR 355

pCMV-SPORT6-AHNAK
PVT12396	Lifescience Market	2 ug	EUR 391

Anti-AHNAK (3G7)
YF-MA11651	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to AHNAK

AHNAK ORF Vector (Human) (pORF)
ORF000271	ABM	1.0 ug DNA	EUR 95

AHNAK ORF Vector (Human) (pORF)
ORF000272	ABM	1.0 ug DNA	EUR 95

Phospho-Desmoyokin (Ser5782) Blocking Peptide
AF8084-BP	Affbiotech	1mg	EUR 195

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

AHNAK Antibody, HRP conjugated
1-CSB-PA600257LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

AHNAK Antibody, FITC conjugated
1-CSB-PA600257LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

AHNAK Antibody, Biotin conjugated
1-CSB-PA600257LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against AHNAK. Recognizes AHNAK from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

pECMV-3-FLAG-AHNAK
PVT12974	Lifescience Market	2 ug	EUR 703

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

AHNAK sgRNA CRISPR Lentivector set (Human)
K0061301	ABM	3 x 1.0 ug	EUR 339

Desmoyokin (Phospho-Ser5782) Polyclonal Conjugated Antibody
C12452	SAB	100ul	EUR 397

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

AHNAK Nucleoprotein 2 (AHNAK2) Antibody
20-abx334216	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

AHNAK Polyclonal Antibody, HRP Conjugated
A68820	EpiGentek	100 ?g	EUR 628.55
Description: reagents widely cited

AHNAK Polyclonal Antibody, FITC Conjugated
A68821	EpiGentek	100 ?g	EUR 628.55
Description: Ask the seller for details

AHNAK Polyclonal Antibody, Biotin Conjugated
A68822	EpiGentek	100 ?g	EUR 628.55
Description: The best epigenetics products

Ahnak ORF Vector (Rat) (pORF)
ORF063203	ABM	1.0 ug DNA	EUR 5859

Ahnak ORF Vector (Mouse) (pORF)
ORF038300	ABM	1.0 ug DNA	EUR 506

Ahnak ORF Vector (Mouse) (pORF)
ORF038301	ABM	1.0 ug DNA	EUR 6078

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

AHNAK sgRNA CRISPR Lentivector (Human) (Target 1)
K0061302	ABM	1.0 ug DNA	EUR 154

AHNAK sgRNA CRISPR Lentivector (Human) (Target 2)
K0061303	ABM	1.0 ug DNA	EUR 154

AHNAK sgRNA CRISPR Lentivector (Human) (Target 3)
K0061304	ABM	1.0 ug DNA	EUR 154

Recombinant human Neuroblast differentiation-associated protein AHNAK
P2806	FN Test	100ug	Ask for price
Uniprot ID: Q09666 Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neuroblast differentiation-associated protein AHNAK

AHNAK Protein Vector (Human) (pPB-His-MBP)
PV320670	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPB-His-GST)
PV320671	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPB-C-His)
PV001081	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPB-N-His)
PV001082	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPM-C-HA)
PV001083	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPM-C-His)
PV001084	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPB-C-His)
PV001085	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPB-N-His)
PV001086	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPM-C-HA)
PV001087	ABM	500 ng	EUR 329

AHNAK Protein Vector (Human) (pPM-C-His)
PV001088	ABM	500 ng	EUR 329

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT	SBI	1 Kit	EUR 153
Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)
LV707235	ABM	1.0 ug DNA	EUR 316

AHNAK Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)
LV707239	ABM	1.0 ug DNA	EUR 316

AHNAK Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)
LV707240	ABM	1.0 ug DNA	EUR 316

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT	SBI	1 kit	EUR 2132
Category: Gene Editing

AHNAK Nucleoprotein 2 (AHNAK2) Antibody (HRP)
20-abx337228	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

AHNAK Nucleoprotein 2 (AHNAK2) Antibody (FITC)
20-abx337229	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

AHNAK Nucleoprotein 2 (AHNAK2) Antibody (Biotin)
20-abx337230	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ahnak sgRNA CRISPR Lentivector set (Rat)
K6382701	ABM	3 x 1.0 ug	EUR 339

Ahnak sgRNA CRISPR Lentivector set (Mouse)
K3256801	ABM	3 x 1.0 ug	EUR 339

vWF Acty. Kit
ABP-ACT-KIT	Abpcorp	12 x 8 microwells	EUR 428

vWF Ant. Kit
ABP-TOT-KIT	Abpcorp	12 x 8 microwells	EUR 394

AHNAK Protein Vector (Human) (pPM-N-D-C-HA)
PV320672	ABM	500 ng	EUR 552

AHNAK Protein Vector (Human) (pPM-N-D-C-His)
PV320673	ABM	500 ng	EUR 552

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT	SBI	1 kit	EUR 2152
Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT	SBI	10 rxn	EUR 445
Category: Cas9

Monoclonal AHNAK Antibody (monoclonal) (M01), Clone: 3G7
AMM03249G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human AHNAK (monoclonal) (M01). The antibodies are raised in mouse and are from clone 3G7. This antibody is applicable in WB, IP, E

Ahnak sgRNA CRISPR Lentivector (Rat) (Target 1)
K6382702	ABM	1.0 ug DNA	EUR 154

Ahnak sgRNA CRISPR Lentivector (Rat) (Target 2)
K6382703	ABM	1.0 ug DNA	EUR 154

Ahnak sgRNA CRISPR Lentivector (Rat) (Target 3)
K6382704	ABM	1.0 ug DNA	EUR 154

Ahnak sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3256802	ABM	1.0 ug DNA	EUR 154

Ahnak sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3256803	ABM	1.0 ug DNA	EUR 154

Ahnak sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3256804	ABM	1.0 ug DNA	EUR 154

AHNAK Protein Vector (Mouse) (pPB-C-His)
PV153198	ABM	500 ng	EUR 603

AHNAK Protein Vector (Mouse) (pPB-N-His)
PV153199	ABM	500 ng	EUR 603

AHNAK Protein Vector (Mouse) (pPM-C-HA)
PV153200	ABM	500 ng	EUR 603

AHNAK Protein Vector (Mouse) (pPM-C-His)
PV153201	ABM	500 ng	EUR 603

AHNAK Protein Vector (Mouse) (pPB-C-His)
PV153202	ABM	500 ng	EUR 8865

AHNAK Protein Vector (Mouse) (pPB-N-His)
PV153203	ABM	500 ng	EUR 8865

AHNAK Protein Vector (Mouse) (pPM-C-HA)
PV153204	ABM	500 ng	EUR 8865

AHNAK Protein Vector (Mouse) (pPM-C-His)
PV153205	ABM	500 ng	EUR 8865

AHNAK Protein Vector (Rat) (pPB-C-His)
PV252810	ABM	500 ng	EUR 8552

AHNAK Protein Vector (Rat) (pPB-N-His)
PV252811	ABM	500 ng	EUR 8552

AHNAK Protein Vector (Rat) (pPM-C-HA)
PV252812	ABM	500 ng	EUR 8552

AHNAK Protein Vector (Rat) (pPM-C-His)
PV252813	ABM	500 ng	EUR 8552

Ahnak 3'UTR Luciferase Stable Cell Line
TU101545	ABM	1.0 ml	Ask for price

Ahnak 3'UTR GFP Stable Cell Line
TU151545	ABM	1.0 ml	Ask for price

Ahnak 3'UTR Luciferase Stable Cell Line
TU200419	ABM	1.0 ml	Ask for price

Ahnak 3'UTR GFP Stable Cell Line
TU250419	ABM	1.0 ml	Ask for price

AHNAK 3'UTR GFP Stable Cell Line
TU050501	ABM	1.0 ml	EUR 1394

AHNAK 3'UTR Luciferase Stable Cell Line
TU000501	ABM	1.0 ml	EUR 1394

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0061305	ABM	3 x 1.0 ug	EUR 376

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)
LV707236	ABM	1.0 ug DNA	EUR 316

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)
LV707237	ABM	1.0 ug DNA	EUR 374

AHNAK Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)
LV707238	ABM	1.0 ug DNA	EUR 374

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0061306	ABM	1.0 ug DNA	EUR 167

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0061307	ABM	1.0 ug DNA	EUR 167

AHNAK sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0061308	ABM	1.0 ug DNA	EUR 167

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)
CASCL9-100A-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)
K6382705	ABM	3 x 1.0 ug	EUR 376

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3256805	ABM	3 x 1.0 ug	EUR 376

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS
AP-STR-KIT-P	CORNING	1/pk	EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)
K6382706	ABM	1.0 ug DNA	EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6382707	ABM	1.0 ug DNA	EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)
K6382708	ABM	1.0 ug DNA	EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3256806	ABM	1.0 ug DNA	EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3256807	ABM	1.0 ug DNA	EUR 167

Ahnak sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3256808	ABM	1.0 ug DNA	EUR 167

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2	CORNING	1/pk	EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Human Kit ELISA Kit
ELA-E0121h	Lifescience Market	96 Tests	EUR 824

Human KIT/SCFR ELISA kit
LF-EK50791	Abfrontier	1×96T	EUR 648

KIT ELISA Kit (Human) (OKAN04574)
OKAN04574	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.61 ng/mL

KIT ELISA Kit (Human) (OKCD06003)
OKCD06003	Aviva Systems Biology	96 Wells	EUR 648
Description: Description of target: This gene encodes the human homolog of the proto-oncogene c-kit. C-kit was first identified as the cellular homolog of the feline sarcoma viral oncogene v-kit. This protein is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). Mutations in this gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.61ng/mL

Human Pentosidine ELISA Kit
201-12-0005	SunredBio	96 tests	EUR 440
This Pentosidine ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Amylin ELISA Kit
201-12-0017	SunredBio	96 tests	EUR 440
This Amylin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human visfatin ELISA Kit
201-12-0026	SunredBio	96 tests	EUR 440
This visfatin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Secretin ELISA Kit
201-12-0027	SunredBio	96 tests	EUR 440
This Secretin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human omentin ELISA Kit
201-12-0156	SunredBio	96 tests	EUR 440
This omentin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

human Resistin ELISA KIT
201-12-0339	SunredBio	96 tests	EUR 440
This Resistin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Collectin ELISA Kit
201-12-0354	SunredBio	96 tests	EUR 440
This Collectin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Agrin ELISA Kit
201-12-0414	SunredBio	96 tests	EUR 440
This Agrin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Thymosin ELISA Kit
201-12-0416	SunredBio	96 tests	EUR 440
This Thymosin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human talin ELISA Kit
201-12-0620	SunredBio	96 tests	EUR 440
This talin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ponticulin ELISA Kit
201-12-0633	SunredBio	96 tests	EUR 440
This ponticulin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Slit2 ELISA Kit
201-12-0662	SunredBio	96 tests	EUR 440
This Slit2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human trypsin ELISA Kit
201-12-0805	SunredBio	96 tests	EUR 440
This trypsin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Elastase ELISA Kit
201-12-0812	SunredBio	96 tests	EUR 440
This Elastase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-glucosidase ELISA Kit
201-12-0854	SunredBio	96 tests	EUR 440
This ?-glucosidase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human ?-lactamase ELISA Kit
201-12-0856	SunredBio	96 tests	EUR 440
This ?-lactamase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Methylase ELISA Kit
201-12-0927	SunredBio	96 tests	EUR 440
This Methylase ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human AHNAK(Desmoyokin) ELISA Kit